ID: 982560307

View in Genome Browser
Species Human (GRCh38)
Location 4:156921478-156921500
Sequence AAGGAGGAGGAGAAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9527
Summary {0: 5, 1: 82, 2: 431, 3: 1929, 4: 7080}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982560302_982560307 8 Left 982560302 4:156921447-156921469 CCAGAGAACTTGGTGACTGTAAG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 982560307 4:156921478-156921500 AAGGAGGAGGAGAAGGAGAAAGG 0: 5
1: 82
2: 431
3: 1929
4: 7080
982560301_982560307 16 Left 982560301 4:156921439-156921461 CCAGACATCCAGAGAACTTGGTG 0: 1
1: 0
2: 1
3: 9
4: 143
Right 982560307 4:156921478-156921500 AAGGAGGAGGAGAAGGAGAAAGG 0: 5
1: 82
2: 431
3: 1929
4: 7080

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982560307 Original CRISPR AAGGAGGAGGAGAAGGAGAA AGG Intronic
Too many off-targets to display for this crispr