ID: 982560307 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:156921478-156921500 |
| Sequence | AAGGAGGAGGAGAAGGAGAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 9527 | |||
| Summary | {0: 5, 1: 82, 2: 431, 3: 1929, 4: 7080} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 982560302_982560307 | 8 | Left | 982560302 | 4:156921447-156921469 | CCAGAGAACTTGGTGACTGTAAG | 0: 1 1: 0 2: 0 3: 8 4: 126 |
||
| Right | 982560307 | 4:156921478-156921500 | AAGGAGGAGGAGAAGGAGAAAGG | 0: 5 1: 82 2: 431 3: 1929 4: 7080 |
||||
| 982560301_982560307 | 16 | Left | 982560301 | 4:156921439-156921461 | CCAGACATCCAGAGAACTTGGTG | 0: 1 1: 0 2: 1 3: 9 4: 143 |
||
| Right | 982560307 | 4:156921478-156921500 | AAGGAGGAGGAGAAGGAGAAAGG | 0: 5 1: 82 2: 431 3: 1929 4: 7080 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 982560307 | Original CRISPR | AAGGAGGAGGAGAAGGAGAA AGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||