ID: 982560632

View in Genome Browser
Species Human (GRCh38)
Location 4:156924954-156924976
Sequence CCTCACACAGTGAAAGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982560628_982560632 26 Left 982560628 4:156924905-156924927 CCAGGAAGAGACAGGATGCAGGC 0: 1
1: 0
2: 3
3: 33
4: 304
Right 982560632 4:156924954-156924976 CCTCACACAGTGAAAGAGTCAGG 0: 1
1: 0
2: 1
3: 16
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982560632 Original CRISPR CCTCACACAGTGAAAGAGTC AGG Intronic
902988421 1:20169934-20169956 CCTCACACAGTGTAAGTCTCAGG - Intronic
903831687 1:26178936-26178958 CCTCCCCCAGTGAAGGAGCCTGG + Intronic
904332262 1:29767722-29767744 CCTCACACACTGGAAGAGGGAGG - Intergenic
905694716 1:39965998-39966020 CCTCACACAGGGAAACGGTGAGG + Exonic
908909999 1:69062267-69062289 CCTCACACAGAGACAGAGGGAGG + Intergenic
909708424 1:78615197-78615219 CCTCACACAGAGTAAGAGGAAGG + Intergenic
910356081 1:86357269-86357291 CCTGTCTCAGGGAAAGAGTCTGG - Intronic
912942256 1:114055778-114055800 CCTCACACAGAGACAGAGCAGGG - Intergenic
915734361 1:158075356-158075378 GCTCCCACAGTGAAGGAGGCGGG + Intronic
918310452 1:183281869-183281891 CCTCACACAGCGCAGGAGTCGGG + Intronic
920300896 1:204988207-204988229 CCTCAAAGGGTGAAAGGGTCTGG - Intronic
921467543 1:215507482-215507504 CCAGACTCAGTGAAAGATTCAGG + Intergenic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1062897182 10:1112767-1112789 CCTCACAGAATTGAAGAGTCAGG - Intronic
1068594234 10:58885496-58885518 ACTCAATGAGTGAAAGAGTCAGG + Intergenic
1069862783 10:71481833-71481855 CCCCACACAGTGCGAGACTCAGG - Intronic
1071213677 10:83373822-83373844 CATTACACAGTGAAAGATTGAGG + Intergenic
1073795206 10:106979808-106979830 CCTCCCACAGTGGCAGAGTGAGG - Intronic
1074412474 10:113240213-113240235 CATTACACAGAGAAAGAGTCAGG + Intergenic
1074905956 10:117863873-117863895 ACTTACACAGTGAAAGGATCTGG + Intergenic
1075551754 10:123397715-123397737 CCCGACACAGTGAAAGACACAGG - Intergenic
1075594583 10:123719347-123719369 CCTAACACTGTGAAACAGTTTGG - Intronic
1076199969 10:128550441-128550463 CTTTACACAGAGAAAGAGTCTGG + Intergenic
1076616342 10:131757593-131757615 CCACAGACAGTGAAAGACACTGG + Intergenic
1077101754 11:825592-825614 CCTCACACGGTGACACAGTGGGG + Intergenic
1078082999 11:8217578-8217600 TCTCTCACAGTGAAGGAGTGAGG - Intergenic
1078156752 11:8806298-8806320 GGTCACACAGAGGAAGAGTCTGG + Intronic
1080693596 11:34581173-34581195 TCTCACACAGAGAAAGAAACGGG - Intergenic
1080886776 11:36375280-36375302 TCACACACAATGAAAGAGACTGG - Intronic
1081214619 11:40380662-40380684 CCTTACACAGTAAAAGAGGAAGG - Intronic
1084359282 11:68659295-68659317 CCGGACACAATGCAAGAGTCTGG + Intergenic
1084399449 11:68935196-68935218 CCTCACGCTGTGAAACAGCCAGG - Intronic
1084779116 11:71397133-71397155 GCTCACACAGTGACGGAGGCCGG - Intergenic
1084800789 11:71542548-71542570 TCTCACACAGTGAAAGCTCCAGG + Intronic
1086929573 11:92677989-92678011 CCTCCCACAGTCAATCAGTCTGG - Intronic
1087567442 11:99879279-99879301 CCTCACAAAATCAAAGAGTAAGG + Intronic
1087829295 11:102801503-102801525 CCTAACAGAGAGAAAGTGTCTGG + Intergenic
1089358426 11:117870720-117870742 CCTGAAACAGAGACAGAGTCAGG - Intronic
1090406260 11:126477347-126477369 CCACACACAGGGAAAGGGACGGG - Intronic
1100922749 12:99507513-99507535 ATTCACAGAGTGAAACAGTCTGG - Intronic
1101585387 12:106081216-106081238 GATCACACAGTGAATCAGTCTGG - Intronic
1103965743 12:124638296-124638318 CCTCACGCGGTGAAAGGGACGGG - Intergenic
1104780549 12:131417228-131417250 CCTTGCACAGTGAAAGTATCAGG + Intergenic
1107896301 13:44967233-44967255 CTTCAGAAAGTGAAAGAGGCCGG + Intronic
1108935816 13:55878823-55878845 CCTCACACAGTGAAAAGCTTTGG - Intergenic
1109225738 13:59692632-59692654 AATGACACAGTGAAATAGTCAGG + Intronic
1110953166 13:81520497-81520519 ACTGAGACAGTGAAAGAGACCGG + Intergenic
1114061165 14:19016736-19016758 CCTCACCCACTGAAAGAAGCAGG + Intergenic
1114101089 14:19383243-19383265 CCTCACCCACTGAAAGAAGCAGG - Intergenic
1115790403 14:36871258-36871280 CCTCACATGGTGAAAGAGCAAGG - Intronic
1117448307 14:55826415-55826437 CATCAAAGAGTGAAAGAGACAGG - Intergenic
1119742024 14:77019994-77020016 GGTCACACAGTGGCAGAGTCTGG - Intergenic
1121271713 14:92642048-92642070 CAACACACACTGAAAGAGGCAGG - Intronic
1121622710 14:95361365-95361387 GGTCACACAGTGAAAGCATCTGG + Intergenic
1122329176 14:100901508-100901530 CCTCACACAGTGACAGGGCTGGG - Intergenic
1122943209 14:104992572-104992594 CCTCACACAATGACACAGTCAGG - Intronic
1124722791 15:32125354-32125376 CCTGAAAGAGTAAAAGAGTCAGG + Intronic
1127686967 15:61355560-61355582 ACTCCCACAGTGAAAGAATTTGG + Intergenic
1129513344 15:76140730-76140752 GGTCACACAGTGACAGAGACGGG + Intronic
1131267359 15:90924689-90924711 CCTCACACAGTAAAAAAGGCAGG - Intergenic
1133803523 16:9104696-9104718 CCTGACACAGTGGAATAGTTAGG + Intronic
1137873912 16:51977229-51977251 TCTCCCACAGCAAAAGAGTCTGG + Intergenic
1139660240 16:68415875-68415897 CCTCACAAAGTAAAAGAGAAAGG + Intronic
1141843646 16:86591900-86591922 CCTCATAAAGTGAAAGAGACAGG + Intergenic
1142140740 16:88471672-88471694 CCACACACAGTGGAGGGGTCAGG + Intronic
1142235390 16:88920080-88920102 CCCCAGATAGTGAAAGGGTCAGG + Intronic
1142780831 17:2179967-2179989 TCTCAGTAAGTGAAAGAGTCAGG - Intronic
1144009614 17:11134193-11134215 CCACACACAGTTATAGAGTTGGG + Intergenic
1144807488 17:17977530-17977552 CCTCAAACAGAGAAAGAAGCAGG + Intronic
1146923190 17:36727437-36727459 CCCCACACAGGGCAAGAGTGGGG - Intergenic
1148439784 17:47705977-47705999 CTTCTCACAGTGAAACAGACAGG - Intronic
1150008175 17:61482589-61482611 CCTCTCACTCTGCAAGAGTCAGG + Intronic
1152086671 17:78223908-78223930 CCTTCCACAGTGAATGTGTCTGG + Exonic
1153320543 18:3769976-3769998 CTTCAGACAATGAATGAGTCAGG + Intronic
1156266479 18:35493068-35493090 GCTCACACAGTGTTAGTGTCGGG - Intronic
1157983589 18:52411257-52411279 CTTCACACTGTGAAAGAGCATGG + Intronic
1158780173 18:60639473-60639495 CATCAGACAGTGAAGAAGTCTGG - Intergenic
1159105651 18:64000124-64000146 TCTGACAAAGTGGAAGAGTCCGG + Intronic
1160056613 18:75488277-75488299 CCTCGCACAGTGATAGATCCTGG + Intergenic
1161330096 19:3682852-3682874 CCTCACACAGTTTCTGAGTCAGG - Intronic
1163288488 19:16364049-16364071 ACTCACACAGACAAGGAGTCTGG - Intronic
1168084968 19:54038843-54038865 CCTTACATAGTGAAAGAGACTGG - Intergenic
1168417585 19:56178825-56178847 CCTTACACAGTGGAACACTCTGG + Intronic
925116145 2:1379649-1379671 CCCCACACAGGGAAAGTGCCAGG - Intronic
925455570 2:4013869-4013891 CCCCAGAGAGTGAAAGAGTTGGG + Intergenic
925456598 2:4021678-4021700 CCTCACATGGTGGAAGAGTGGGG + Intergenic
925626953 2:5850907-5850929 CCTAACACAGTGAATGGCTCTGG + Intergenic
929478849 2:42282323-42282345 CTTAACATACTGAAAGAGTCAGG + Intronic
931461375 2:62453172-62453194 CTTCTCCCAGGGAAAGAGTCAGG - Intergenic
932234904 2:70113016-70113038 AATCACACAGTGACAGAGCCAGG - Intergenic
933233114 2:79832088-79832110 TCTCACACAGGGAATGAGTATGG - Intronic
933766488 2:85712740-85712762 ACTGATACAGTGAAAAAGTCTGG + Intergenic
935287106 2:101574757-101574779 ACTCACACAGAGAAAGTTTCCGG - Intergenic
935305579 2:101733278-101733300 CATCACACACTCAAAGAGTGAGG - Intronic
937936142 2:127247112-127247134 CCTTACAAAGTGAAAGAGGCCGG + Intergenic
938102114 2:128504424-128504446 CCACACACACTGAGAGCGTCAGG - Intergenic
939684993 2:145188411-145188433 CCTCACAAGGTGAAAGGGTGAGG + Intergenic
943869793 2:192979443-192979465 CCTCCCACATTGACAGGGTCAGG - Intergenic
944783738 2:203046662-203046684 CCTCACACAGAGGAAGGGGCAGG + Intronic
945785601 2:214232568-214232590 CCTCTGACTGTGAAGGAGTCGGG + Intronic
946903351 2:224393617-224393639 ACTCACACAGTGAAGGAGGATGG - Intronic
947349840 2:229232018-229232040 CCTCACACAGTGGAAGGCTAAGG + Intronic
949017032 2:241719326-241719348 CCTCACTCAGTGCATGAGGCAGG + Intronic
1169466826 20:5849025-5849047 CCTCACAAAGTGAGAGTGTGTGG - Intronic
1170002633 20:11632024-11632046 CCTCACTCAGTAAAATAGCCAGG - Intergenic
1170014950 20:11769862-11769884 CATCACAGAGTGAGGGAGTCCGG - Intergenic
1175310442 20:58008089-58008111 CCTCACCCAGTGAAAGCTCCAGG - Intergenic
1176226192 20:64001069-64001091 CCTCACAGAGTGAAGATGTCTGG + Exonic
1180139664 21:45885650-45885672 CATAACAGAGTGAAAGAGTCAGG - Intronic
1180479650 22:15739348-15739370 CCTCACCCACTGAAAGAAGCAGG + Intergenic
1182473929 22:30565615-30565637 CCTCACCCAGGGATAGAGGCAGG - Intronic
1182500523 22:30743468-30743490 CATCACCCAGTGAAGGAGGCAGG + Intronic
1183703025 22:39460434-39460456 AGTCACACAGTGAGAGAGGCAGG - Intronic
1183761918 22:39828707-39828729 CCTCAAACAGGAAAAGAGTAAGG + Intronic
1184898251 22:47424993-47425015 GCTCACACAATTATAGAGTCTGG - Intergenic
949555451 3:5148548-5148570 CCTCACCCAGTGAAAGGCCCTGG - Intronic
951096642 3:18639548-18639570 CATCACACAATGATAGAGCCAGG + Intergenic
951869525 3:27345636-27345658 CCTCTAACATTGAAAGTGTCAGG - Intronic
954894621 3:53964927-53964949 CCCTACACTGTGAAAGAGTTGGG + Intergenic
956088645 3:65640169-65640191 GCTCACACAGTTATAGAGACTGG - Intronic
957122355 3:76111442-76111464 CCTCACAAAGTGAAACATCCAGG - Intronic
962482384 3:135808929-135808951 CCTTTCAGGGTGAAAGAGTCTGG + Intergenic
962814690 3:138987634-138987656 CCAAACAGAGTGAAGGAGTCTGG - Intergenic
963607598 3:147424328-147424350 CCTCAGACTGCGACAGAGTCTGG - Intronic
966731439 3:183154633-183154655 CCTCACACAGGCAAAGGGGCTGG - Intronic
967146546 3:186611565-186611587 CCACACACAGTTCAGGAGTCAGG + Intergenic
967782269 3:193452491-193452513 CATCACAAAGTGAGAGAGTTGGG + Intronic
968359785 3:198138847-198138869 CCCCACAGACTGAGAGAGTCAGG + Intergenic
969625750 4:8304550-8304572 CCCCAGCTAGTGAAAGAGTCTGG - Intronic
970153006 4:13109720-13109742 GCTCACACAGTTATAGAGTTTGG - Intergenic
977202356 4:94132193-94132215 ACTCACCCAGTGATATAGTCTGG + Intergenic
982560632 4:156924954-156924976 CCTCACACAGTGAAAGAGTCAGG + Intronic
982760363 4:159275877-159275899 CTTCACAGAGTAAAAGTGTCTGG - Intronic
983635095 4:169889805-169889827 CCTCACATAGTAGAAGAGACAGG - Intergenic
984549282 4:181141476-181141498 CCTCACACAGTCAAAGACAGGGG - Intergenic
986003526 5:3648971-3648993 CCTCACCCAGTGAAAGAGGCAGG - Intergenic
986943490 5:12986056-12986078 CCTCATCCAGTGAAGGAGGCTGG - Intergenic
988847383 5:35141911-35141933 CCTCACAGAGTGGAGGAGACGGG - Intronic
990705752 5:58527589-58527611 CGCCATACAGTGAAAGAGTGTGG - Intergenic
991697774 5:69288947-69288969 CCTTCCACAGTGTAAGAGACAGG - Intronic
995190755 5:109317081-109317103 CCTCACAGAGCTGAAGAGTCAGG - Intergenic
1002763928 6:223526-223548 CCTCACACACCTAAGGAGTCTGG - Intergenic
1003968148 6:11272998-11273020 CCTCCCACAGAGATAGGGTCTGG + Intronic
1004354899 6:14922387-14922409 ACTCACACCGTAAATGAGTCAGG + Intergenic
1004931144 6:20464333-20464355 CCTCACACAGTTCCAGAGTCAGG + Intronic
1005702124 6:28412618-28412640 CGTCACACAGTGGAAGGGTATGG + Intergenic
1006930276 6:37683615-37683637 CCTCACCCAGTGACAGAGGCGGG + Intronic
1009701843 6:67194239-67194261 CTTCACACATTTAAAGAGTAAGG + Intergenic
1009811990 6:68680033-68680055 CCTCACATAGTGAAAGGGACAGG - Intronic
1011863222 6:91786736-91786758 CCTGAAACAGTGAAAGAAACTGG + Intergenic
1013351070 6:109306249-109306271 ACTTGCACAGTGGAAGAGTCTGG + Intergenic
1014539033 6:122651679-122651701 CAACACACAGTGTGAGAGTCTGG + Intronic
1014710179 6:124797057-124797079 CCACTCACAGTGATAGAATCAGG + Intronic
1016544804 6:145209011-145209033 CCTCCCGCAGTGAGAGAGGCTGG + Intergenic
1017125652 6:151061900-151061922 CCTCACAAAATGACAAAGTCAGG + Intronic
1018723996 6:166596792-166596814 CCTCACAGAGTGTATTAGTCAGG - Intronic
1019023078 6:168935393-168935415 GTTCAGACAGTGAAAGAGTTTGG - Intergenic
1019260203 7:77803-77825 CCCCACAGACTGAGAGAGTCAGG - Intergenic
1020548980 7:9573837-9573859 CTTCACAGAGTGAGAGAGTTAGG + Intergenic
1023743118 7:43298582-43298604 CCTCACACACTGCAAGACTAGGG - Intronic
1024385079 7:48741800-48741822 ACTCACACAGTGATGGAGTGGGG - Intergenic
1029484734 7:100833157-100833179 CCTCACACAGTGCTAGAATTAGG - Intronic
1030225404 7:107144824-107144846 CCTAACACAGACAAAGAGTGGGG - Intronic
1032486637 7:132292638-132292660 CCTCACCCAGAGAAAGGGCCAGG - Intronic
1032907747 7:136391181-136391203 CCTCACACAGTGAACTTGTTTGG - Intergenic
1037436091 8:18865100-18865122 CCTAGCACAGTGAATGAATCCGG + Intronic
1038281271 8:26167401-26167423 ACTGAAACAGTGAAAGAGTGTGG - Intergenic
1039185990 8:34916854-34916876 CCACACACAATGGAAGAATCAGG + Intergenic
1039231512 8:35453867-35453889 CCACACTCAGTGAAAGGGGCTGG + Intronic
1039442096 8:37602126-37602148 GCTCTCACAGTGATAGAATCTGG - Intergenic
1041698489 8:60762444-60762466 GCTCACTAAGTGACAGAGTCGGG - Intronic
1041799935 8:61787767-61787789 CCACACATTGTGAAAGAGTGTGG + Intergenic
1041872785 8:62653764-62653786 CCTCTCACAGTGGAACAGTAGGG - Intronic
1042176852 8:66045798-66045820 CCTCACACAGGAAAAGATACTGG + Intronic
1043673983 8:82925885-82925907 CCTCATCCAGTAAAATAGTCTGG + Intergenic
1046183368 8:110681924-110681946 CCTCACATAATGAAAGAGTTGGG + Intergenic
1047276170 8:123407229-123407251 TCTCTCACAGTTCAAGAGTCTGG - Intronic
1048252029 8:132874555-132874577 CCTCACACATGGAAAGAAACTGG - Intronic
1048724698 8:137369842-137369864 TCTGACACAGTGAAAGAGATAGG - Intergenic
1050663313 9:7907700-7907722 CCTCACACATAGATAGAGTGTGG + Intergenic
1051303830 9:15685688-15685710 ATTCACACAGTAAAAGTGTCAGG - Intronic
1053004119 9:34593161-34593183 CCTCACACAGTGCCAGCGCCCGG + Intergenic
1053274777 9:36775063-36775085 CCTCAAACATTGAAAGAGATGGG + Intergenic
1057599357 9:96443829-96443851 CCTCAGCAAGTGGAAGAGTCAGG - Intergenic
1059516581 9:114901429-114901451 CCACTCACAGTGCAAAAGTCAGG + Intronic
1062744488 9:138202668-138202690 CCCCACAGACTGAGAGAGTCAGG + Intergenic
1185460233 X:329847-329869 CCTCACCCAATGTCAGAGTCAGG - Intergenic
1186434462 X:9531196-9531218 ACTCACACAGTAAATGAGTCAGG + Intronic
1186771425 X:12821712-12821734 ACTCACACAGTGAAAAAATGGGG + Intronic
1190491223 X:50984081-50984103 CCACACAGAGAGAAGGAGTCAGG - Intergenic
1194839129 X:98716594-98716616 ACTCACACACTGAAAGAACCAGG - Intergenic
1196275182 X:113758342-113758364 CCTCACACAGAGAAAGAATGGGG + Intergenic
1196887391 X:120261155-120261177 CCTCACAGAGTTAATGAGCCTGG + Intronic
1201962599 Y:19698697-19698719 TCTCACACAGTGGAAGGGACAGG + Intergenic