ID: 982562438

View in Genome Browser
Species Human (GRCh38)
Location 4:156946538-156946560
Sequence TCACTATTACCTCAGAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982562438_982562442 4 Left 982562438 4:156946538-156946560 CCCCTTTTCTGAGGTAATAGTGA 0: 1
1: 0
2: 1
3: 8
4: 184
Right 982562442 4:156946565-156946587 AAATTTGCCTAGGTCCCCGAAGG 0: 1
1: 0
2: 0
3: 3
4: 39
982562438_982562441 -6 Left 982562438 4:156946538-156946560 CCCCTTTTCTGAGGTAATAGTGA 0: 1
1: 0
2: 1
3: 8
4: 184
Right 982562441 4:156946555-156946577 TAGTGAGCTCAAATTTGCCTAGG 0: 1
1: 0
2: 1
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982562438 Original CRISPR TCACTATTACCTCAGAAAAG GGG (reversed) Intronic
903058600 1:20654027-20654049 TCACTACTACCTTAAAAAATTGG + Intronic
903569764 1:24295567-24295589 ACACATTTACCTCAGAAAATAGG - Intergenic
906912455 1:49969187-49969209 TCAGTAATACCTCAATAAAGTGG - Intronic
907024786 1:51106042-51106064 TCTCTATTACGACAGAAAATAGG - Intronic
908028640 1:59976431-59976453 TCTCTATTTCCTCAGAAAGAAGG - Intergenic
908059862 1:60336033-60336055 TCACCATTAGCTCAGGAAATTGG - Intergenic
909378995 1:74975330-74975352 GCACTCTAACCACAGAAAAGTGG + Intergenic
909648863 1:77950914-77950936 TCTCTGTTACCCAAGAAAAGAGG - Intronic
909694560 1:78451683-78451705 TCACAATAATCTCATAAAAGAGG - Intronic
911881579 1:103245911-103245933 GCACTAGAATCTCAGAAAAGGGG - Intergenic
911948925 1:104147522-104147544 TCTCTGTTACCTCAGATAATGGG + Intergenic
912229806 1:107779483-107779505 TTTCTATAACCTGAGAAAAGAGG + Exonic
913208517 1:116563921-116563943 TGAATTTTTCCTCAGAAAAGGGG + Intronic
913397727 1:118390640-118390662 TCACTATCACCACTAAAAAGAGG + Intergenic
915338531 1:155162797-155162819 TAACTCTTAACCCAGAAAAGGGG + Intergenic
915544822 1:156591185-156591207 TAGCTATTATCTCAGTAAAGGGG + Intergenic
916427875 1:164698987-164699009 GCACTACAACCTCAGAAGAGGGG + Intronic
916712495 1:167424438-167424460 TCACTACTACCACAGATGAGGGG - Exonic
919112256 1:193235914-193235936 TCCCTATTACATTGGAAAAGTGG + Intronic
919396489 1:197055888-197055910 TCATTATTTTCTAAGAAAAGAGG + Exonic
919506785 1:198408959-198408981 TTACTCTTACCTCAGGAAAATGG + Intergenic
919535611 1:198783773-198783795 AAACTATTACCTCCCAAAAGAGG + Intergenic
921323265 1:213964807-213964829 TCAATATTCCACCAGAAAAGAGG - Intergenic
923961562 1:239090106-239090128 TGACTACTACATCAAAAAAGAGG + Intergenic
1064242090 10:13640092-13640114 TAACTGGTACCTCAGAAATGTGG - Intronic
1064277314 10:13917990-13918012 TCACTATTACCTTAGTCAACAGG + Intronic
1067707526 10:48620961-48620983 TCACTGTCACTTCACAAAAGTGG + Intronic
1068047643 10:51908240-51908262 TCTCTATTTCCTCAGCAAACAGG - Intronic
1069040748 10:63693529-63693551 TAAATATTGCCTCAGAAAATGGG - Intergenic
1069621360 10:69839408-69839430 TCAATTATACCTCAGTAAAGTGG - Intronic
1070557830 10:77542915-77542937 TCCGTATTAAGTCAGAAAAGAGG - Intronic
1070953835 10:80451914-80451936 TCACTAGGAACTCAGAAGAGAGG - Intergenic
1073751768 10:106536987-106537009 GAGCTGTTACCTCAGAAAAGGGG + Intergenic
1076060107 10:127407391-127407413 TCATCAGTGCCTCAGAAAAGAGG - Intronic
1076181595 10:128413303-128413325 TCACTATTTCTTCATGAAAGAGG + Intergenic
1076411258 10:130252701-130252723 TCACTTTGACCTCTGAGAAGCGG - Intergenic
1076753796 10:132557561-132557583 TCAACATCAACTCAGAAAAGAGG - Intronic
1079300936 11:19278457-19278479 TCACTATATCCTTAGAAAAGAGG + Intergenic
1079628136 11:22640860-22640882 ACACTATTAGCTAAGAAAAGGGG + Intronic
1081876650 11:46413077-46413099 TCCTTCCTACCTCAGAAAAGAGG + Intronic
1082828734 11:57599696-57599718 CCACTAATTCCTCAGAGAAGGGG - Intronic
1082948758 11:58788510-58788532 TCTCTATTACCTCAGGCAATAGG - Intergenic
1085432349 11:76463673-76463695 TCAATCTTCCCTCAGAGAAGTGG - Intronic
1085620437 11:78033995-78034017 TCATCATTACCTCTGGAAAGAGG + Intronic
1086212232 11:84334432-84334454 TCACTTGAAACTCAGAAAAGTGG - Intronic
1088883364 11:113988824-113988846 TCACAATAGCCTCACAAAAGAGG - Intronic
1089068283 11:115678855-115678877 ACACTAATACCTGACAAAAGGGG - Intergenic
1091155887 11:133372422-133372444 TCACAACAACCTCAGAAAACAGG - Intronic
1093876873 12:24358929-24358951 TCACGTTTACCTTAGAAAGGAGG + Intergenic
1094548200 12:31424871-31424893 TCACTATTTTGTCAGAAAAATGG + Intronic
1097880815 12:64684810-64684832 CCACAGTTACCTCAGCAAAGAGG + Exonic
1098774194 12:74590347-74590369 TAAATATGACCTTAGAAAAGAGG + Intergenic
1100664490 12:96736477-96736499 TCACTAAGAACTAAGAAAAGGGG + Intronic
1102287897 12:111674198-111674220 TCACAATTACCTCATTAGAGGGG - Intronic
1102812741 12:115838355-115838377 TCAACATTTCCTCAAAAAAGAGG + Intergenic
1103033785 12:117640171-117640193 TTACTATTACATCAGAAACTGGG + Intronic
1106028107 13:25974381-25974403 TCCCTTTTACCTCAGACTAGGGG - Intronic
1109277969 13:60322999-60323021 TCAATATTACCTTGAAAAAGAGG - Intergenic
1110306866 13:73998183-73998205 TCACAATTACCTCAGAGTACAGG + Intronic
1112280541 13:98059256-98059278 TCACTATAACCTCACAAAGTAGG + Intergenic
1113501934 13:110782533-110782555 TGACTTTTTCCTCAGAAAATGGG + Intergenic
1114448224 14:22806404-22806426 TCACGCTTACCTAAAAAAAGAGG - Intronic
1115007207 14:28499607-28499629 TGAATTTTACCTCAGAAAATAGG + Intergenic
1115658659 14:35468286-35468308 GCACAAGTACCTTAGAAAAGCGG + Intergenic
1116532480 14:45989772-45989794 TCAGTATTTCCTCCCAAAAGGGG + Intergenic
1116713805 14:48402809-48402831 GCAGTATTATCTCAGAAAATAGG - Intergenic
1117703700 14:58441115-58441137 TCAATTATACCTCAGTAAAGTGG + Intronic
1118375226 14:65171044-65171066 CCACTTTCATCTCAGAAAAGGGG - Intergenic
1126037535 15:44560503-44560525 TTTCTATTAACTCAGAAAAGGGG - Intronic
1129340784 15:74885101-74885123 TCACATTGACCTCAGATAAGGGG - Intergenic
1134381262 16:13728664-13728686 TCAATAATACCTCAATAAAGTGG - Intergenic
1134467989 16:14495887-14495909 TCACTGTTTCCTCTGAAGAGGGG + Intronic
1136408052 16:30060631-30060653 CTGCCATTACCTCAGAAAAGAGG - Intronic
1140265733 16:73418871-73418893 TCATTATTACCACAGAAATCAGG - Intergenic
1155753626 18:29461576-29461598 TAACTATTACTTCATAACAGTGG + Intergenic
1156376531 18:36519700-36519722 CCTCTCTTACCTCAGAACAGAGG - Intronic
1156856538 18:41788733-41788755 TCACTCTTAGCTCAGGAAACAGG - Intergenic
1158758122 18:60350769-60350791 TCACAATGCCCTTAGAAAAGGGG - Intergenic
1159131478 18:64284957-64284979 GCACTATTTCCTTACAAAAGAGG + Intergenic
1159675094 18:71273737-71273759 TAACTATTACCTCAAGACAGAGG + Intergenic
1159970156 18:74640940-74640962 TCACCAATAGCTTAGAAAAGAGG - Intronic
1164322673 19:24164013-24164035 TTACTTTTTCCTCAGGAAAGTGG - Intergenic
1167452481 19:49580269-49580291 TCACTATAAACTCAGTCAAGTGG - Intronic
1167836365 19:52074839-52074861 TCACTGCTAGCTCAAAAAAGAGG + Intronic
930254800 2:49077581-49077603 TGACTATTTCCTCAGAAATTGGG + Intronic
930315564 2:49793047-49793069 TAACTCTTAGCTCAGAAAGGAGG - Intergenic
937536698 2:122897474-122897496 TCCCTATCACCAAAGAAAAGGGG + Intergenic
937747429 2:125431006-125431028 TCACTATCACATCAGAGATGGGG + Intergenic
937769951 2:125709020-125709042 TCACTCTTACCTCACAAAGCTGG + Intergenic
939012812 2:136866495-136866517 TCACTCTTAACTCTGAAAAAAGG + Intronic
939215140 2:139227572-139227594 ACAGTGTTACCACAGAAAAGAGG - Intergenic
940539043 2:154987141-154987163 TCTCTATTAGATCAAAAAAGTGG + Intergenic
940553674 2:155194577-155194599 TCCCTTTTCCCTCTGAAAAGGGG - Intergenic
940938243 2:159524577-159524599 ACACTCTGACCTGAGAAAAGGGG + Intronic
943154242 2:184152490-184152512 TCAATTATACCTCAGTAAAGTGG - Intergenic
943247160 2:185470464-185470486 TCACTTTTAACCTAGAAAAGAGG + Intergenic
946085895 2:217171125-217171147 TCACCAATCCCACAGAAAAGAGG - Intergenic
1173799779 20:45887605-45887627 TCACTATTCCCTCACAAACCGGG - Exonic
1176071534 20:63229234-63229256 TCCCTGAAACCTCAGAAAAGAGG + Intergenic
1176954433 21:15084842-15084864 TCCCTATTATCTTAGAGAAGTGG - Intergenic
1177927437 21:27235678-27235700 TCATTATTTACTCAGAAAAATGG + Intergenic
1178272141 21:31200531-31200553 TCATCGTTACCTCAGAACAGTGG + Intronic
1179237777 21:39562739-39562761 TCAAAATTAACTCAGCAAAGGGG - Intronic
1180863988 22:19105426-19105448 TCACTCTTGCCTCAGGACAGAGG - Intronic
952641319 3:35600273-35600295 TCTCTAGTTCCTCAGCAAAGGGG + Intergenic
952732004 3:36648402-36648424 TCAATATTACATAAGAAAACTGG - Intergenic
952798489 3:37265546-37265568 TCAATCATACCTCAGTAAAGTGG - Intronic
954035954 3:47851309-47851331 GCACTGCTACCTCAGAAAGGGGG + Intronic
954821402 3:53332056-53332078 TCACTATTCCCTCAGCAAGGTGG - Intronic
957823577 3:85411189-85411211 GCAATATGACTTCAGAAAAGAGG + Intronic
958114578 3:89199238-89199260 TGAAAATTACCTCAGTAAAGTGG - Intronic
958136460 3:89500625-89500647 TCACTATAACCTCAGACATTTGG + Intergenic
958469876 3:94503409-94503431 TGACTTTTTCCTCAGAAAATGGG + Intergenic
959743727 3:109752009-109752031 TCCCTCTGACATCAGAAAAGAGG - Intergenic
959794345 3:110405754-110405776 TCAATCATACCTCAGCAAAGTGG + Intergenic
961142478 3:124566997-124567019 TGACTATCACCCCAGAAATGGGG + Intronic
962642792 3:137405934-137405956 TCAGTTATGCCTCAGAAAAGGGG + Intergenic
964341302 3:155711431-155711453 GCACTTTTAACTAAGAAAAGTGG + Intronic
964348691 3:155781460-155781482 TCACTATTACTTAAAAATAGTGG + Intronic
964704750 3:159606282-159606304 TCATTTTCACCTCAAAAAAGTGG + Intronic
965312686 3:167150351-167150373 TCACTATTGCCTCAGAAGAAAGG - Intergenic
966195445 3:177309283-177309305 TCAATTATACCTCAGTAAAGCGG - Intergenic
966556083 3:181261529-181261551 TCAATCATACCTCAGTAAAGTGG - Intergenic
967526094 3:190494581-190494603 TCACTGCTACCTTAGAAAAATGG - Intergenic
967533954 3:190580972-190580994 TCAATCATACCTCAGTAAAGTGG + Intronic
970017239 4:11525793-11525815 TCACTGACACCTCAGACAAGAGG + Intergenic
970880580 4:20925068-20925090 TCACTATTTTCTCATAAAACAGG + Intronic
973882509 4:55288242-55288264 TCACTATTACCTGAGAAGTCTGG + Intergenic
974926414 4:68304256-68304278 TCACTATTTCTACAGAAAAATGG - Intergenic
975214492 4:71738023-71738045 TCAATATCTCCTCAGAAAATGGG - Intergenic
976219980 4:82748586-82748608 TCTTTATTACTCCAGAAAAGTGG + Intronic
978988013 4:115039747-115039769 TAACATTTACCTAAGAAAAGAGG + Intronic
981437260 4:144739799-144739821 GCCCTCTTACCCCAGAAAAGGGG + Exonic
981857390 4:149310654-149310676 TCTCTATTAGCTCACAAATGTGG + Intergenic
982562438 4:156946538-156946560 TCACTATTACCTCAGAAAAGGGG - Intronic
987885902 5:23811701-23811723 AAATTATTACCTCATAAAAGAGG - Intergenic
988032078 5:25775683-25775705 TCACTTATACCTCAATAAAGTGG + Intergenic
989324514 5:40175619-40175641 GTTCTATTACCTCATAAAAGGGG + Intergenic
989754481 5:44936138-44936160 TCACTAGTGCCTCAGTGAAGAGG - Intergenic
990133630 5:52618851-52618873 TCACTATCACAACAGCAAAGGGG - Intergenic
990957832 5:61361481-61361503 TCAATATTTACTTAGAAAAGAGG - Intronic
992492946 5:77262961-77262983 TTACTATTACATCAGAAAAAAGG - Intronic
993059843 5:83025992-83026014 TCACCTTTACCTCAGGAACGAGG - Intergenic
993173347 5:84450319-84450341 GGACTATTACCTTAGAAAATTGG - Intergenic
995491715 5:112699997-112700019 TAAATAATACCTCAGCAAAGAGG - Intergenic
999856313 5:155598454-155598476 TCACTATGACCTCAGGAAGTGGG - Intergenic
1002257926 5:177972731-177972753 TCACTATTTCCTCAGAAGCTTGG + Intergenic
1003217305 6:4126125-4126147 TAACTCTTACCTCAGTAAAACGG + Exonic
1005403381 6:25458829-25458851 TCATAATTACCCCAGAAGAGAGG - Intronic
1007448987 6:41928904-41928926 TGAGTAGGACCTCAGAAAAGAGG + Intronic
1008683308 6:53897345-53897367 TCAGAATTACCTCAGGTAAGTGG + Exonic
1012051991 6:94358495-94358517 TAACAATTATCTTAGAAAAGAGG - Intergenic
1013830842 6:114270877-114270899 TAACAATTATCACAGAAAAGTGG + Intronic
1016262764 6:142192895-142192917 TCTGTATTTCCTCAGAAGAGTGG + Intronic
1018283370 6:162211871-162211893 TCTCTACTACCTCTTAAAAGAGG + Intronic
1018445929 6:163858339-163858361 CCACTAGTACATCAGAACAGGGG + Intergenic
1018914161 6:168122561-168122583 TCAGAATGACCTCAGAGAAGGGG - Intergenic
1020564355 7:9777383-9777405 TCACTATGTTCTCAGAAAAATGG - Intergenic
1020580577 7:9994475-9994497 TAACTAGTACCACAGACAAGTGG - Intergenic
1023710640 7:42988705-42988727 ACACTGCTACCTCAGAAAAAGGG - Intergenic
1024446047 7:49480321-49480343 TAACTATGCACTCAGAAAAGAGG + Intergenic
1025763114 7:64413569-64413591 TCACCTTTTCCTCAGAAAAGTGG + Intergenic
1027676888 7:81171059-81171081 TCTCTGTTACCTTGGAAAAGTGG - Intergenic
1028080061 7:86564640-86564662 TCACTATTTCCTGAGAATATGGG - Intergenic
1028129777 7:87156291-87156313 TCACTATTACTTGAGTAAGGAGG - Intronic
1029023280 7:97387864-97387886 TAACTATACCCTCAGTAAAGGGG + Intergenic
1032373432 7:131383862-131383884 TCACAATAAACTCAGGAAAGAGG - Intronic
1032504668 7:132426084-132426106 TCATTCCTGCCTCAGAAAAGGGG + Intronic
1032602240 7:133310009-133310031 TCACTATTAACTGAGTAAAAAGG - Intronic
1033072792 7:138220319-138220341 TGACTTTTTCCTCAGAAAATCGG - Intergenic
1037618503 8:20542921-20542943 TCTCAATTACATCAGAAAAAGGG + Intergenic
1041322498 8:56628161-56628183 TCCCTATTACATCAGAAAAGTGG - Intergenic
1041765288 8:61412438-61412460 TCACTCAGACCTCAGAAAATAGG + Intronic
1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG + Exonic
1043337229 8:79191500-79191522 TCACTATAATCTCAGAATATTGG + Intergenic
1045815832 8:106274807-106274829 TCACTATTCCCTTGGGAAAGAGG - Intronic
1045977355 8:108144867-108144889 TCACTATTCCCTCTTAAGAGAGG - Intergenic
1047535359 8:125714467-125714489 TTAATATTACATTAGAAAAGAGG - Intergenic
1048415768 8:134226056-134226078 TATCTCTTACCTCAGAGAAGGGG - Intergenic
1051969037 9:22864490-22864512 TCAATATTCCCTAAGAAAATTGG + Intergenic
1056316732 9:85397472-85397494 TCTCTATTTCCTCAAACAAGAGG - Intergenic
1056837555 9:89969353-89969375 CCCCTATTACCTCATAGAAGTGG - Intergenic
1187220156 X:17317999-17318021 TCAATAATACCTCAATAAAGTGG + Intergenic
1189516300 X:41716439-41716461 TCCCGGATACCTCAGAAAAGCGG - Intronic
1190239417 X:48645867-48645889 TCCCTATTGTCTCAAAAAAGTGG + Intergenic
1192242486 X:69344305-69344327 ACACTATTAACTCAGTAAAAAGG - Intergenic
1193026492 X:76851138-76851160 TCTCTGTTGCCTCAGAAAATGGG + Intergenic
1193987010 X:88254784-88254806 ACAATATTACCTCAAAAAAGAGG - Intergenic
1194394621 X:93366948-93366970 TCAATATGACCTCAGAACACAGG - Intergenic
1194796255 X:98214605-98214627 TCATTCTTCACTCAGAAAAGAGG + Intergenic
1195969825 X:110461135-110461157 TCACTTCTCCCTCAGGAAAGGGG + Intergenic
1196543247 X:116934189-116934211 TGAATTTTACCTCAGAAAATGGG - Intergenic
1199445799 X:147919373-147919395 TCACTATTACTTCAACAGAGAGG - Intronic
1201418027 Y:13767548-13767570 ACACTATTAATCCAGAAAAGTGG - Intergenic