ID: 982564360

View in Genome Browser
Species Human (GRCh38)
Location 4:156970680-156970702
Sequence CCAGACTGTGAAGGTATCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 145}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982564360 Original CRISPR CCAGACTGTGAAGGTATCTT TGG (reversed) Intronic
902369140 1:15994411-15994433 TCAGACTTGGAAGGTATCTGTGG + Intergenic
904549239 1:31301569-31301591 TAAGACTTTGAAGGGATCTTAGG + Intronic
907143312 1:52209073-52209095 CCAGACTATTAAGGTTTCTCAGG - Intronic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
908601620 1:65745392-65745414 CCAGCCTGTGAAGGTAGCTGTGG + Intergenic
909466927 1:75982982-75983004 CCAGACTGAGAAGATGGCTTGGG - Intergenic
910527973 1:88202725-88202747 ACAGATTGTGAGGGTGTCTTAGG + Intergenic
911088540 1:93999659-93999681 CTAGACTGTGGAGGAAGCTTTGG - Intronic
920669659 1:207993609-207993631 CCAGGCTCTGAAGGGAGCTTAGG + Intergenic
924706885 1:246509360-246509382 TCAGACGCTGAAGGTATCTGTGG - Intergenic
1063764544 10:9123320-9123342 CCAGAATGTGTAGCTATTTTAGG - Intergenic
1064788725 10:18930752-18930774 GTAGTCTGTGAAAGTATCTTTGG - Intergenic
1066799438 10:39167948-39167970 CCATTCTGTGAATGTATATTTGG + Intergenic
1066799580 10:39170007-39170029 CCATTCTGTGAATGTATATTTGG + Intergenic
1066801445 10:39196779-39196801 ACAGTCTGTGAAGGGATATTTGG - Intergenic
1067531098 10:47074124-47074146 CTTGACTGTAAAGGTTTCTTAGG + Intergenic
1069541828 10:69300176-69300198 AAAGACTGTGAAGGGATTTTGGG - Intronic
1073519832 10:104117655-104117677 CAATACTGTGAAATTATCTTGGG + Intergenic
1077665317 11:4103055-4103077 CCGCACTGCTAAGGTATCTTAGG + Intronic
1077915605 11:6609743-6609765 CCAGGCTGTGAAGTTTGCTTTGG + Exonic
1079279242 11:19072927-19072949 CCAAACTGTGCAGTTATCTGTGG - Intergenic
1079768396 11:24425153-24425175 AAATACTATGAAGGTATCTTTGG + Intergenic
1079870799 11:25795216-25795238 CCAGACTGTGAACTCATGTTGGG - Intergenic
1082144520 11:48650214-48650236 CCAGTCTGTGAATGGATGTTTGG + Intergenic
1082304548 11:50555135-50555157 ACAAACTGTGAAGGGATATTTGG - Intergenic
1082306786 11:50587849-50587871 CCATTCTGTGAATGTATATTTGG + Intergenic
1082594285 11:55055932-55055954 ACAATCTGTGAAGGTATATTTGG - Intergenic
1084872277 11:72106249-72106271 CAAGACAGTGAAGGAATATTTGG + Intronic
1085278280 11:75313993-75314015 CCAGATTGTGAAGAGCTCTTGGG - Intronic
1085742371 11:79088222-79088244 CCAGAGGGTGATGGTATCTAGGG + Intronic
1086095007 11:83041389-83041411 CCAGACAGTGGAGGTGCCTTTGG - Intronic
1086669772 11:89532257-89532279 CCAGCCTGTGAAAGTAGCTATGG + Intergenic
1089274440 11:117325027-117325049 CCAGACTGGGAAGGAATTCTGGG - Intronic
1089629787 11:119777409-119777431 CCAGCCTGTCAAGGTCTTTTTGG + Intergenic
1090712279 11:129398141-129398163 GCAGACTGTGATGGTGACTTGGG + Intronic
1094864066 12:34508106-34508128 CCATTCTGTGAATGGATCTTTGG - Intergenic
1099534095 12:83824343-83824365 TCAGACTTTAAACGTATCTTTGG + Intergenic
1102188995 12:110971765-110971787 CCAGGCAGTGAAGGCTTCTTTGG + Intergenic
1102503057 12:113366036-113366058 CCAGACATTGAGGGTATCTAAGG - Intronic
1104845798 12:131846143-131846165 CCAGACTGTGAGGGAAACTCCGG - Intronic
1109482406 13:62973575-62973597 CCAGCCTGTGAAAGTAGCTGGGG - Intergenic
1109491100 13:63100998-63101020 CCAGACTGTGAAAGCAGCTGTGG + Intergenic
1112501159 13:99944414-99944436 GCAGACTGTGTGGGTATCCTAGG + Intergenic
1114487904 14:23074668-23074690 ACAGACTGTTAAGCTATGTTGGG - Intronic
1114951085 14:27754423-27754445 CCAGAAAGTGAAGGTACATTCGG + Intergenic
1116829094 14:49700284-49700306 CCAGCCTGTGAAGATACTTTGGG - Intronic
1119697182 14:76722169-76722191 AGAGGCTGGGAAGGTATCTTTGG - Intergenic
1119862203 14:77944284-77944306 CAATACTGTGAAGGTATTTAGGG + Intergenic
1120745566 14:88147964-88147986 CCACACTGTTATGGGATCTTTGG - Intergenic
1125349135 15:38749525-38749547 CAAGACTGTAAAAGTATCATTGG - Intergenic
1134141316 16:11722122-11722144 GCAAAGTGTGAAGGTATGTTTGG - Intronic
1135017522 16:18936262-18936284 CCAGTCTGTGAGGGTATTTTTGG + Intergenic
1136052237 16:27660071-27660093 CAAGCCTGGGAAGGTAGCTTGGG + Intronic
1138921340 16:61533223-61533245 CCAGGATGAGCAGGTATCTTTGG + Intergenic
1141325350 16:83052277-83052299 CCAGACTGTCAACATTTCTTTGG + Intronic
1143143026 17:4753432-4753454 CCAGTGTGTGAAGTTAACTTGGG - Intergenic
1148470821 17:47892156-47892178 CCCCAGTGGGAAGGTATCTTTGG + Intergenic
1149814865 17:59713739-59713761 GGAGACTAAGAAGGTATCTTAGG + Intronic
1154198287 18:12281792-12281814 CCAGTCTGTGAAGGTCACTGCGG + Intergenic
1155914893 18:31547203-31547225 TCAGACTGTGCATGTATCTTTGG - Exonic
1156841696 18:41616681-41616703 CCAGACTGAGAATTTATCTTTGG - Intergenic
1158654326 18:59315451-59315473 CCAGACTGAGAGGATATATTTGG - Intronic
1158862147 18:61603156-61603178 TCAGAATGGGAAGGTATCTGAGG + Intergenic
933841497 2:86290302-86290324 CAAGAATGTGAAGGAATTTTGGG + Intronic
933976962 2:87519486-87519508 CCAGAATGTGTAGGAATCATGGG + Intergenic
934486274 2:94715265-94715287 CCAGAAAGTGAAGGTACATTCGG - Intergenic
935641691 2:105296992-105297014 CAAGACTTTGGAGGTATTTTTGG - Intronic
935865725 2:107385561-107385583 CCAGACTGTGCCTGTATCTTAGG - Intergenic
936316855 2:111431318-111431340 CCAGAATGTGTAGGAATCATGGG - Intergenic
938951463 2:136258522-136258544 TCAGACTGTCAAGGTGTATTTGG + Intergenic
941035749 2:160567580-160567602 CTACACTGTGAAGGTACCTCTGG + Intergenic
945268553 2:207915156-207915178 ACACACTGGGAAGGTAACTTAGG + Intronic
947945022 2:234093802-234093824 ACAGACTGTGAAGACATCTCTGG - Intergenic
948009635 2:234641078-234641100 CCAAGCAGAGAAGGTATCTTTGG + Intergenic
948095560 2:235331367-235331389 CCAGGCTGTCAAGATATTTTTGG + Intergenic
1171076447 20:22130821-22130843 CCAGAGTGTGATGTTATCTGTGG - Intergenic
1171307344 20:24117749-24117771 CCAGGGTGTGAAGGAAACTTTGG - Intergenic
1173148058 20:40542429-40542451 ACAAACTGTGAAGGGATCTGGGG + Intergenic
1173979410 20:47211681-47211703 CCAGGATGTGATGGGATCTTAGG - Intronic
1181691443 22:24564231-24564253 CAGGACTGTGAAGGTGTGTTGGG - Intronic
1182724285 22:32430202-32430224 TCAGAGTCTGAAGGTACCTTAGG + Intronic
1182954566 22:34410148-34410170 TGAGACAGTGAAGGAATCTTCGG - Intergenic
1184581377 22:45420124-45420146 CCAGACTGTGAAGGCGTTGTAGG - Intronic
951635468 3:24770139-24770161 CTAGACTGTGGTGGTTTCTTGGG - Intergenic
952200385 3:31120340-31120362 CTAGAATTTTAAGGTATCTTTGG + Intergenic
952478018 3:33731354-33731376 CCAGCCTGTGAAAGGGTCTTGGG - Intergenic
954361977 3:50126861-50126883 CCTGACTGTGTAGGTCTCCTGGG + Intergenic
954679230 3:52332768-52332790 CCAGAAAGTAAAGTTATCTTAGG - Intronic
965245770 3:166265823-166265845 CCAGAGTTTGAAGGTAGTTTAGG + Intergenic
965617673 3:170611563-170611585 GCAGGCTGTGCAGTTATCTTGGG - Intronic
965749371 3:171960409-171960431 CCAGACTGTGCAGGATTCTAGGG + Intergenic
966090405 3:176128862-176128884 CAAGAATGTGAAGGTTTCTGTGG + Intergenic
966668316 3:182497747-182497769 ACAGACTGTGTAGGTTTCATAGG + Intergenic
968829729 4:2926932-2926954 CCAGCCTTTGAGGGTCTCTTTGG + Intronic
969681380 4:8645244-8645266 CCAGAGTGTGAGGGGATCCTGGG - Intergenic
970744757 4:19281429-19281451 CCAGACTGTGAAAGCAGCTGTGG - Intergenic
971991662 4:33905766-33905788 ACAGACTGGGAAGGCATATTTGG + Intergenic
972706016 4:41543691-41543713 CCAGACTGTGGCGCTATGTTTGG - Intronic
973036666 4:45415747-45415769 CAAGACAGTGAAGGTGTATTGGG - Intergenic
976108159 4:81641556-81641578 CCAGATTTTGAGGGTATATTAGG - Intronic
977879743 4:102190246-102190268 CTAGACTGTGAAGGTAAAATAGG + Intergenic
978246915 4:106583971-106583993 CTTGACTGTGAAAATATCTTAGG + Intergenic
978734948 4:112075363-112075385 TCAGATTGTGAATGTATATTAGG - Intergenic
981585857 4:146301413-146301435 CCAGACTGTGAAGGGCTTTGGGG + Intronic
982198921 4:152940806-152940828 CAAGACTGTGCAGGTAATTTTGG - Intronic
982564360 4:156970680-156970702 CCAGACTGTGAAGGTATCTTTGG - Intronic
983907458 4:173198736-173198758 GCAGCCTGTGAAGGTGTCTGTGG - Intronic
984639919 4:182151143-182151165 CTATACTGGGATGGTATCTTAGG + Intronic
984838730 4:184048537-184048559 CCTGAATGTGAAGGTCTTTTGGG + Intergenic
985505352 5:276776-276798 CCACACTGAGAAGGTATTTGTGG + Intronic
986804884 5:11300310-11300332 CCAGGCTGTGAAGTTCCCTTGGG - Intronic
993809050 5:92452803-92452825 CAGAACTGTGAAGGTATTTTCGG - Intergenic
997153627 5:131527213-131527235 CCAAACTGTTTAGGTATTTTTGG + Intronic
999448220 5:151658463-151658485 CCAGACTGGGCAGGGATGTTAGG + Intergenic
1000688723 5:164287710-164287732 CCAGACTGTGAAGCCATCTTAGG - Intergenic
1001179592 5:169507137-169507159 CAAGACTGGCAAGATATCTTTGG + Intergenic
1006947551 6:37795209-37795231 CCAAGTTGTGATGGTATCTTTGG - Intergenic
1007067069 6:39001528-39001550 CCAGGCTGTGGAGGTAACTTGGG + Intronic
1009254169 6:61355014-61355036 CCATTCTGTGAAGGTATATTTGG + Intergenic
1009258855 6:61456835-61456857 CCATTCTGTGAAGGTATATTTGG + Intergenic
1009260252 6:61477255-61477277 CCATTCTGTGAAGGGATATTTGG + Intergenic
1009261236 6:61491806-61491828 GCAAACTTTGAAGGTATATTTGG - Intergenic
1012938566 6:105393032-105393054 CCAGACTGAAAAGGTATGGTGGG + Intronic
1013931359 6:115537826-115537848 CCAGACTTTGAGGTTATCTAGGG - Intergenic
1014695202 6:124612106-124612128 CCAGACTATATAGGTATTTTGGG + Intronic
1014834690 6:126147664-126147686 ACAGACTGTGAAGGAAGCTGTGG + Intergenic
1025525100 7:61796699-61796721 ACAAACTGTGAAGGGATATTTGG - Intergenic
1025548480 7:62209263-62209285 ACAAACTGTGAAGGGATATTTGG - Intergenic
1025585512 7:62780360-62780382 ACAGACTGTGAAAGGATATTTGG + Intergenic
1025592840 7:62884574-62884596 CCATTCTGTGAAGGGATATTTGG + Intergenic
1025598347 7:62961222-62961244 CCATTCTGTGAATGTATGTTTGG + Intergenic
1026435392 7:70392527-70392549 CCAAACTGTGAGGTAATCTTTGG + Intronic
1026890270 7:73977612-73977634 CCAGGCTCTGAAGGTCTCTCGGG - Intergenic
1027811940 7:82914676-82914698 TCAGACAGTGAAGGTAAATTGGG - Exonic
1028232865 7:88326473-88326495 CCAGACTGTGAATGTATCTAAGG + Intergenic
1029814580 7:103080062-103080084 CAAGACTGTGAAAGAATCTTAGG - Intronic
1031052352 7:116956542-116956564 CCTGATTGTGATGGTGTCTTTGG - Exonic
1038398336 8:27263577-27263599 GCAGACTGTGAATGAGTCTTAGG + Intergenic
1042789773 8:72591383-72591405 CCAGACTATTAAGGTATATTAGG - Intronic
1046329987 8:112701650-112701672 GCACACTCTGAAGGTAACTTGGG + Intronic
1048277096 8:133074843-133074865 CCAGTGTGTGAAGGTATTTTGGG - Intronic
1049401950 8:142432000-142432022 CCAGGCTCTGAAGACATCTTAGG + Intergenic
1049910859 9:266396-266418 CAAGACTGTGAAGGAATGGTTGG - Intronic
1050289027 9:4134445-4134467 CCAGCTTGTGAATGTAACTTTGG + Intronic
1053376837 9:37614544-37614566 CCCCACTGTGAAGGTTTTTTGGG - Intronic
1053671525 9:40369060-40369082 CCAGAAAGTGAAGGTACATTCGG + Intergenic
1054362266 9:64185727-64185749 CCATTCTGTGAAGGTATATTTGG + Intergenic
1054364087 9:64213863-64213885 GCAAACTTTGAAGGTATATTTGG - Intergenic
1054382635 9:64509109-64509131 CCAGAAAGTGAAGGTACATTCGG + Intergenic
1054513092 9:66007250-66007272 CCAGAAAGTGAAGGTACATTCGG - Intergenic
1055294505 9:74820514-74820536 CCAGACTGAAAAGGTGTCTATGG + Intronic
1055352046 9:75399536-75399558 CCAGGCTGAGAAGGTATCAATGG - Intergenic
1056237173 9:84606120-84606142 CCAGACTGAGATGGTACTTTTGG - Intergenic
1059999893 9:119948768-119948790 CTGGACTATGAAGGAATCTTAGG - Intergenic
1060245478 9:121942307-121942329 CCTGACTGTGAAGGTGACATTGG - Intronic
1186554695 X:10545467-10545489 ACAAACTCTGAAGGTATTTTTGG + Intronic
1189329891 X:40137729-40137751 CCAGACAGTGGAGGTTTCTGGGG + Intronic
1193748223 X:85309908-85309930 TGAGACTGTGAAGGGAGCTTGGG + Intronic
1199222902 X:145338057-145338079 CCAGACTGTAGTGGTTTCTTTGG - Intergenic
1199334829 X:146606415-146606437 CCAGACTGAGGAGGTATCAGAGG - Intergenic
1199768680 X:150959435-150959457 GCAGGCTGTTAAGGCATCTTCGG - Intergenic