ID: 982564592

View in Genome Browser
Species Human (GRCh38)
Location 4:156971681-156971703
Sequence CCGAGCGGCCGAATTGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982564592_982564598 -10 Left 982564592 4:156971681-156971703 CCTGGGGCAATTCGGCCGCTCGG No data
Right 982564598 4:156971694-156971716 GGCCGCTCGGGGTCACCGCGGGG No data
982564592_982564606 27 Left 982564592 4:156971681-156971703 CCTGGGGCAATTCGGCCGCTCGG No data
Right 982564606 4:156971731-156971753 CGTCCCCTCCCCCCACGCCTCGG No data
982564592_982564600 -4 Left 982564592 4:156971681-156971703 CCTGGGGCAATTCGGCCGCTCGG No data
Right 982564600 4:156971700-156971722 TCGGGGTCACCGCGGGGCTCCGG No data
982564592_982564607 28 Left 982564592 4:156971681-156971703 CCTGGGGCAATTCGGCCGCTCGG No data
Right 982564607 4:156971732-156971754 GTCCCCTCCCCCCACGCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982564592 Original CRISPR CCGAGCGGCCGAATTGCCCC AGG (reversed) Intergenic