ID: 982567357

View in Genome Browser
Species Human (GRCh38)
Location 4:157002473-157002495
Sequence GAGGAACTCAAACTGGATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982567357_982567362 30 Left 982567357 4:157002473-157002495 CCCTAATCCAGTTTGAGTTCCTC No data
Right 982567362 4:157002526-157002548 CCAAATAATATCACCTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982567357 Original CRISPR GAGGAACTCAAACTGGATTA GGG (reversed) Intergenic
No off target data available for this crispr