ID: 982570531

View in Genome Browser
Species Human (GRCh38)
Location 4:157045341-157045363
Sequence AGCATCTTCGAGGTTTTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982570525_982570531 30 Left 982570525 4:157045288-157045310 CCTCTCTTTTTCTGAACATAATA No data
Right 982570531 4:157045341-157045363 AGCATCTTCGAGGTTTTAGATGG No data
982570529_982570531 3 Left 982570529 4:157045315-157045337 CCTTGGTGTAGGAAAGGAGCTAT No data
Right 982570531 4:157045341-157045363 AGCATCTTCGAGGTTTTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982570531 Original CRISPR AGCATCTTCGAGGTTTTAGA TGG Intergenic
No off target data available for this crispr