ID: 982577121

View in Genome Browser
Species Human (GRCh38)
Location 4:157127393-157127415
Sequence CAGGGTTTGCACTCTGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982577121 Original CRISPR CAGGGTTTGCACTCTGTTGT TGG Intronic
908686943 1:66731170-66731192 CACGGTTTGCACAGTCTTGTGGG - Intronic
909089915 1:71212620-71212642 CAGGGTTTGAACTCTGGTGAAGG + Intergenic
911089041 1:94002758-94002780 CAGGGTTTGCATTTTGAGGTAGG - Intronic
914461703 1:147891176-147891198 CAAGCTCTGCACTCTGATGTAGG - Intergenic
917669368 1:177257639-177257661 CAGAGGTTGCACTCTGGTGGAGG + Intronic
917942746 1:179939452-179939474 CAAGGTTTGCAATCAGATGTAGG + Intergenic
919429139 1:197471304-197471326 CAGGGTTTGAAGTCTCTTGCTGG - Intronic
920673162 1:208020241-208020263 CAGGGTCTGTGCTCTGTTCTGGG + Intergenic
1063515909 10:6695013-6695035 CAGAATTTGCACCCTGTTTTAGG + Intergenic
1064847726 10:19674273-19674295 TAGGCTTTGCACTAGGTTGTAGG - Intronic
1070479537 10:76868916-76868938 CAGAGTTTGCACTCTTTTCAGGG - Intergenic
1071298227 10:84237795-84237817 CATGGCTTGGACTCTGGTGTGGG - Intronic
1072304867 10:94097447-94097469 CATGCTTGGCACACTGTTGTGGG - Intronic
1075031060 10:119025182-119025204 CAGGGTTTGCACCCTGGCGCTGG - Intergenic
1075060041 10:119250288-119250310 TAGGGTTTGAACTCAGTTGTGGG + Intronic
1078871888 11:15354679-15354701 GAGAGTTTGCACTCTCATGTTGG - Intergenic
1081808384 11:45902114-45902136 TAGGGTTTGCTCTCTGTAGTGGG - Intronic
1082206384 11:49440041-49440063 AAGAATGTGCACTCTGTTGTTGG + Intergenic
1083795334 11:65013771-65013793 CAGGATTTGGACTGTGTTGCTGG + Intergenic
1084299545 11:68238167-68238189 CAAGGTTTCCACTCTGAAGTTGG - Intergenic
1087268016 11:96082343-96082365 AAAGGTTTGCACTGTGCTGTGGG + Intronic
1092090739 12:5801881-5801903 CAGGGTTTGCACTCAGGGGAGGG - Intronic
1093383230 12:18520763-18520785 CAGGTGTTGCAGTCAGTTGTAGG + Intronic
1094510785 12:31095311-31095333 CAGGGTTCTGCCTCTGTTGTAGG + Intronic
1098308488 12:69124782-69124804 CAGGGTAAGCACTCAGATGTGGG - Intergenic
1099067171 12:77996284-77996306 CAGTGATTGCACTCTGTTGAAGG - Intronic
1099358571 12:81668609-81668631 CAGGGTTTTTACTCTGTGGAGGG - Intronic
1103132220 12:118479260-118479282 CTGGTTTTGCAGTCTGTTTTTGG + Intergenic
1104937831 12:132375956-132375978 CAGGGAATTCACACTGTTGTGGG + Intergenic
1112302991 13:98247310-98247332 CAGGGTGTGTACTCTGTTGGTGG + Intronic
1112418162 13:99222154-99222176 CAGGGTTTACATTCTGATGAAGG + Intronic
1112616339 13:101010042-101010064 CATTCTTTGCACTCTGTTGTGGG + Intergenic
1116632722 14:47355559-47355581 CAGGCTTTGCACTCTCTAGGTGG + Intronic
1116769491 14:49110750-49110772 CAGGGTTTGAATTCTGGAGTAGG + Intergenic
1124010720 15:25836431-25836453 CAGTGTTGCCACTCTGTTGTTGG - Intronic
1124478240 15:30055045-30055067 CAGGGTCTCCACTCTGTTGTAGG - Intergenic
1125321303 15:38492532-38492554 CAAGGTTTGCACTGTGTTTTTGG - Intronic
1129170344 15:73803761-73803783 AAGGGTTTGCAGTCTGCTGCTGG - Intergenic
1131055826 15:89374247-89374269 TAGGGTTTGCAATTTTTTGTGGG - Intergenic
1131850517 15:96538345-96538367 CAGGCTTTGCATTCTGATATGGG - Intergenic
1131977215 15:97959025-97959047 CAGGTTTTGCATTCTGTACTGGG - Intergenic
1133624619 16:7559555-7559577 CAGGGTTTGCACACAATTCTTGG - Intronic
1134857195 16:17530112-17530134 CAGGGCTTGCATCCTGTTGAAGG - Intergenic
1139683024 16:68580368-68580390 CAGGGATTGGACTCTGGGGTGGG + Intergenic
1140544529 16:75793507-75793529 CAGTGTTTGCATTCTGTTTAAGG - Intergenic
1140892342 16:79295905-79295927 CAATGTTTGCATTCTGCTGTTGG + Intergenic
1141420626 16:83913081-83913103 CAGGGTGTTCACTGTGTTGGGGG + Intronic
1143365485 17:6405761-6405783 CAGTGTTTGCATTCTGTCTTTGG + Intronic
1143642871 17:8209479-8209501 CAGGCTTTGCTCCCTGTTTTTGG - Intronic
1145783305 17:27577909-27577931 CATGGTTTCCTCTCTGTTGAGGG + Intronic
1146404572 17:32526173-32526195 CAGGGTTTACAATCTGGTGGGGG - Intronic
1146992522 17:37287834-37287856 AAGGCTATGCACTCTGCTGTTGG + Intronic
1147412649 17:40264781-40264803 CAAGGGTTTCTCTCTGTTGTAGG - Exonic
1153144982 18:2020965-2020987 AAGGGTTTGAACTCTGGTTTGGG + Intergenic
1157367511 18:47079331-47079353 CAAGGTTTGCACTTTGTAATTGG + Intronic
1157554729 18:48606035-48606057 CTGGCTTGGCAATCTGTTGTGGG + Intronic
1158992738 18:62886569-62886591 CAGCCTTTGCACTTTGTTATAGG + Intronic
1162567946 19:11454357-11454379 CAGGGTGAGCACTCTGGGGTGGG - Exonic
1164834252 19:31347695-31347717 CAGGTTTTGCTCTCTGTCCTCGG - Intronic
1165063061 19:33214223-33214245 CAGGGCTTGCACGCTGCTGTGGG - Intronic
926423088 2:12717543-12717565 CAGCTTTTGCAATCTTTTGTTGG + Exonic
929928565 2:46234674-46234696 CTGGGTTTGCCCTGTGTGGTTGG + Intergenic
931042174 2:58312973-58312995 CAGGGCTTGCAGTCTGTCATGGG + Intergenic
934075495 2:88425006-88425028 CAGTATTCCCACTCTGTTGTTGG - Intergenic
934088556 2:88530703-88530725 CAGGGTTTGGTCTCTGGTGGGGG - Intergenic
935730364 2:106060050-106060072 CAGGGTTCTCCCTCTGTAGTGGG + Intergenic
937912036 2:127080457-127080479 CAGGATTTGCACTCTGTCCAGGG + Intronic
939353244 2:141068353-141068375 AATGCTGTGCACTCTGTTGTGGG - Intronic
945023844 2:205601113-205601135 CAACGTTTTCACACTGTTGTTGG - Intronic
945744805 2:213707335-213707357 CACTGTTTTCACTCTCTTGTTGG + Intronic
947045152 2:225973767-225973789 GAGGGTCTGGCCTCTGTTGTTGG + Intergenic
947826486 2:233108967-233108989 GATGGTGTGCACTCTTTTGTGGG - Intronic
948268122 2:236653539-236653561 CAGTATTTGAACTGTGTTGTTGG + Intergenic
1169358135 20:4924879-4924901 CAGGGCTTTCATTCTGGTGTGGG - Intronic
1172293639 20:33792953-33792975 CGGGGTTTGTACTCACTTGTGGG + Intergenic
1173167624 20:40697002-40697024 CAAGGTTTGCACTGTCTTGGAGG - Intergenic
1175776332 20:61656169-61656191 CAGGGTTTGCACTCTTAGTTAGG + Intronic
1178170607 21:30035545-30035567 CAGGCATTGCACTCTGTGCTAGG + Intergenic
1180073569 21:45450607-45450629 CAGGGTTTGTCCTGTCTTGTTGG - Intronic
1181832053 22:25567985-25568007 CAGGATTTGCACTCATTGGTTGG - Intronic
1182952429 22:34390320-34390342 CAGGGTTTGAGCTCTGCTGAGGG - Intergenic
1182985922 22:34716043-34716065 CAGGGATTGCACTAAGTTCTAGG - Intergenic
1184373741 22:44098729-44098751 CAGAGTTTACACTCTGCTGCCGG + Intronic
1184989572 22:48157743-48157765 GAGGGTTTGCACTCTGAGGCCGG + Intergenic
950224208 3:11220466-11220488 CAGGCTCTGCACTGGGTTGTAGG - Intronic
951137126 3:19117707-19117729 CAGGATTTGCATGCTGTTATGGG - Intergenic
956738707 3:72258672-72258694 CTGGGTTTGCAGTGTGTTGAGGG - Intergenic
956763840 3:72467174-72467196 CAGCTTTTGTACTCTTTTGTTGG - Intergenic
961513906 3:127421027-127421049 CAGGGTGAGTACTCTGTTGGAGG - Intergenic
961701541 3:128748497-128748519 CAGGGGCTGCACTCTCTTGATGG + Intronic
962426873 3:135277955-135277977 CAGGGTTTGCACCCTATGGCTGG + Intergenic
963383685 3:144563421-144563443 CAGGGTCTGTGCTCTGTTCTGGG + Intergenic
966942762 3:184757434-184757456 CAGGGTGTGCACTCTCCTCTGGG - Intergenic
968722326 4:2216811-2216833 CAGTGTTTGGTCTCTGTTGCTGG + Intronic
968970637 4:3791745-3791767 CAGGCTTTGGACTCAGCTGTCGG - Intergenic
969065246 4:4474271-4474293 CAGAGTTTGCAGTCTGGTGAAGG - Intronic
969273244 4:6117111-6117133 CAGGGCTTGAACTCTGTCCTGGG - Intronic
973073264 4:45892336-45892358 ACAGGTTTGGACTCTGTTGTGGG + Intergenic
975067885 4:70091249-70091271 CAGGATTTGGACTCTCTTCTAGG + Intergenic
978402756 4:108348420-108348442 CAGGGTTTAAACTCAGTTGCAGG + Intergenic
978498504 4:109384807-109384829 CAGGGTTTCCTCTCTGTTAAGGG + Intergenic
979264646 4:118687094-118687116 CAGTGTTTGCACAGGGTTGTGGG - Intronic
981758953 4:148172534-148172556 CATCGTTTGGACTCTGTTATAGG + Intronic
982577121 4:157127393-157127415 CAGGGTTTGCACTCTGTTGTTGG + Intronic
983600867 4:169525874-169525896 CTGGGTTTGCACCCTGTTTCTGG + Intronic
985169048 4:187128627-187128649 CAGGGTTAGCACTCTCTGGCTGG - Intergenic
988179500 5:27771811-27771833 CAGGTTTTGCATTTTTTTGTGGG - Intergenic
992170464 5:74096700-74096722 CAGAGATTGCATTCTCTTGTTGG - Intergenic
992610348 5:78503168-78503190 CAGTTCTGGCACTCTGTTGTAGG - Intronic
995784415 5:115813925-115813947 CGTGGTTTGCAGTTTGTTGTTGG - Intronic
996068714 5:119109467-119109489 CAGCGTTTGGACTTTGTTATAGG - Intronic
998900444 5:146847565-146847587 CAGGGCTTGTGCTCTGTTGGTGG + Intronic
999327508 5:150652177-150652199 CAGGGGCTTCACTCTGTTCTGGG - Exonic
1003359186 6:5408094-5408116 CTGGATTTGCACCCTGTTGCAGG + Intronic
1008018437 6:46547825-46547847 CAGAGTTTGCACTCATTTATAGG - Intergenic
1008283617 6:49623910-49623932 CAAATTTTGCACTCTGTTTTGGG + Intronic
1009642505 6:66356284-66356306 TAGAGTTTGCATTCTGTTGGAGG - Intergenic
1010075557 6:71792921-71792943 CAGGATTTGCACTCAATTCTTGG - Intergenic
1011890611 6:92154585-92154607 CATGGTTTGAACACTGTTCTTGG + Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1023815213 7:43944076-43944098 TAGGGTCTGCACGCCGTTGTGGG + Intronic
1023832985 7:44050923-44050945 CACGGTTTGATGTCTGTTGTTGG + Intronic
1026844998 7:73693774-73693796 CAGGGTCTGCACTCTGGGGCTGG - Intronic
1030520913 7:110596870-110596892 TGGAGTTTGCACACTGTTGTAGG - Intergenic
1031212394 7:118847113-118847135 CTGGGTTTGCACACAGTTCTTGG + Intergenic
1038787540 8:30633686-30633708 CAGGGCTGTCACTCTGTTGAGGG - Intronic
1040736610 8:50515922-50515944 CAGAGCTTGCACTCTGTGCTGGG - Intronic
1046031982 8:108793364-108793386 TAGGTTTTGCACTCTGTAGATGG + Intergenic
1047148202 8:122230005-122230027 CAGAGTTTGCACTCACTTCTAGG + Intergenic
1048580434 8:135725944-135725966 CAAGGTTTGCACCCTGATGGGGG - Intergenic
1050417226 9:5430276-5430298 CAGGGTTTTTACTCTTATGTTGG - Intronic
1052998178 9:34562754-34562776 CAGAGTATTCACTCTGTTGGTGG + Intronic
1058225903 9:102362988-102363010 CAGGGATTGCACTCTCACGTGGG + Intergenic
1058457854 9:105154944-105154966 CAGGGACTGCACTCTGTGCTGGG - Intergenic
1059822342 9:117987076-117987098 CAGGGTTTGTACTCTGGTGTTGG - Intergenic
1061218967 9:129237835-129237857 CAGGGCTTGCTCTCTGTACTGGG + Intergenic
1193533594 X:82686354-82686376 GAGGGGTTGCACTGTGCTGTGGG + Intergenic
1195747743 X:108135763-108135785 CTAGGTTTCCACTTTGTTGTTGG - Intronic