ID: 982577243

View in Genome Browser
Species Human (GRCh38)
Location 4:157129245-157129267
Sequence AACAGACCTCTTTTATGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982577243 Original CRISPR AACAGACCTCTTTTATGAGT GGG (reversed) Intronic
903355933 1:22747400-22747422 AACAGACCTTGATTTTGAGTCGG - Intronic
905135673 1:35797503-35797525 AACAAGCCTCTTTTATCTGTAGG - Intergenic
907996394 1:59637127-59637149 ATTAAACCTATTTTATGAGTGGG + Intronic
909107533 1:71431115-71431137 AAAAGACCTTTTTTATGATCAGG + Intronic
909355355 1:74702530-74702552 AACTGACCTCTCTTATGGGCAGG - Intergenic
909904792 1:81181297-81181319 ATCAGAGGTCTTTTATGACTAGG + Intergenic
912541463 1:110419454-110419476 GACTAACCTCCTTTATGAGTTGG + Intergenic
913350166 1:117849310-117849332 TCTAGACCTCTTTTATGAGTGGG + Intergenic
915660982 1:157404667-157404689 CACAGTCCTCTTTTCTGACTGGG - Intergenic
917242103 1:172959741-172959763 TCCACCCCTCTTTTATGAGTTGG - Intergenic
919344774 1:196361425-196361447 CACAGAGCTTTTTTATGAATGGG - Intronic
920804565 1:209220321-209220343 AACAGAACTCTTTTGTGTGATGG + Intergenic
922019391 1:221688365-221688387 AACTGTCCTTTTTAATGAGTTGG - Intergenic
923856538 1:237850933-237850955 AGCAAACCTTTTTTATGAGAAGG + Intergenic
924609444 1:245561681-245561703 AAGAGACAACTTTAATGAGTTGG - Intronic
924682111 1:246247672-246247694 AAAAGGCCTCTTTTAGGTGTGGG - Intronic
924836651 1:247654995-247655017 AAGAGACCTTTTTTATTATTTGG + Intergenic
1063645135 10:7873300-7873322 AACAGACCTATTTTAAAAGGTGG + Intronic
1065076328 10:22083300-22083322 TACAGAACTTTTTGATGAGTTGG + Intergenic
1065882807 10:30051423-30051445 AACAGACCTCTTTCATCATTTGG + Intronic
1066641037 10:37554296-37554318 AACAGTCAGCTTTTGTGAGTTGG - Intergenic
1067715590 10:48688417-48688439 GACAGACCACGTTTATGAATTGG - Intronic
1068579973 10:58728815-58728837 ATCAGACCTCTTTTGTGACCAGG + Intronic
1069173791 10:65264280-65264302 AACAGGCCTCTTTTGGGACTGGG + Intergenic
1069332921 10:67314649-67314671 AACAAAACCCTTTTATGAGCAGG - Intronic
1069407083 10:68113182-68113204 AACAGACCTATGAAATGAGTAGG + Intronic
1070172926 10:73946257-73946279 TACAGTGCTCTTTTATGGGTAGG - Intergenic
1070953579 10:80450068-80450090 AATACAACCCTTTTATGAGTTGG + Intergenic
1073053096 10:100681745-100681767 AAGAGACCACTTTTATAAGGGGG + Intergenic
1079931674 11:26570871-26570893 AAAATGCCTCTTTTATGAGAGGG + Intronic
1083630028 11:64090666-64090688 AACAGACCACTTCTCTGAGGCGG + Intronic
1087998797 11:104848162-104848184 AAAAGACCTCTTTTGTGAGTAGG + Intergenic
1088724472 11:112621980-112622002 AACAGGCCCCCTTTATGCGTTGG + Intergenic
1093260689 12:16933819-16933841 AACAGATATCTTTTTTGAGGTGG + Intergenic
1099070306 12:78037715-78037737 AATAGGCCCCTTTAATGAGTAGG - Intronic
1101880664 12:108623460-108623482 AACAGACCTCTTTTGGTAGTAGG + Exonic
1101961290 12:109252267-109252289 AAAAGAGCTCTTGTATCAGTAGG - Intronic
1103854707 12:123958565-123958587 AACAGACCACTTATGTGAGGAGG - Intronic
1104275393 12:127322449-127322471 AATAGACCTCTGATATGATTTGG - Intergenic
1105759044 13:23496395-23496417 AACAGAACTATTTTGGGAGTTGG + Intergenic
1106952035 13:34894887-34894909 AACAGACTTCCTTTGTGTGTCGG + Intergenic
1107912793 13:45121144-45121166 AAGAGAACACTTTTAAGAGTAGG - Intronic
1108977403 13:56464516-56464538 TTCAGACCCCTTTTATGATTTGG - Intergenic
1115015863 14:28613231-28613253 AAAGGACTTCTTTTATGTGTTGG - Intergenic
1115781827 14:36777352-36777374 AAATGACCTCTGTAATGAGTTGG + Intronic
1116810814 14:49538324-49538346 AACAGAGCTTTTTAATAAGTAGG - Intergenic
1117387095 14:55226490-55226512 AACAGATCTCTTGCAAGAGTTGG + Intergenic
1117681885 14:58212166-58212188 AACACAACTCTTCTATGAGATGG - Intronic
1117903525 14:60560686-60560708 AACATAACCCTTTTATAAGTTGG + Intergenic
1124108362 15:26762634-26762656 AAGAAACCTATTTTATGTGTTGG + Intronic
1125172348 15:36779892-36779914 AACAGACTGCTTTTCTGAGTGGG + Intronic
1125197019 15:37058596-37058618 AACAGAGCTCTTTCCTCAGTGGG + Intronic
1125455533 15:39855122-39855144 AAGAGAGTTCTTTGATGAGTTGG - Intronic
1128708483 15:69854866-69854888 AGCAGACTTCCTTGATGAGTCGG + Intergenic
1129632863 15:77280338-77280360 AACTGACCTTTTTTTTGAGATGG - Intronic
1131768644 15:95710147-95710169 AAAAGTCCTCTTTTCTGTGTGGG + Intergenic
1135884972 16:26297369-26297391 AAAAGCCCTCATTTAGGAGTAGG + Intergenic
1139224776 16:65223615-65223637 AGCAGACACCATTTATGAGTTGG - Intergenic
1141069982 16:80945400-80945422 AAGAGATTTCTTTTTTGAGTGGG - Intergenic
1143563097 17:7706568-7706590 CACAGAACTCTTTTATGAGCGGG - Intronic
1145122483 17:20273179-20273201 CACAGGCCTCTTTTCTGATTAGG - Intronic
1148866756 17:50632838-50632860 ATCAGACCTCCTTTCTGAGATGG - Intergenic
1150368909 17:64618615-64618637 AACAGCCATCAGTTATGAGTGGG - Intronic
1155694771 18:28672069-28672091 CACAAACCTCTTTTATTGGTGGG + Intergenic
1155918879 18:31583240-31583262 AAAAGACCTCTATTATGTGAAGG - Intergenic
1156270213 18:35523736-35523758 AGCAGTCCTCATTTATGAGATGG + Intergenic
1157163402 18:45336039-45336061 AAAAAACCTATTTTATGACTAGG - Intronic
1167841075 19:52120871-52120893 AACGGACCACTTTTATAAATAGG + Intronic
930381188 2:50632086-50632108 AACAGTCCTCATTTATGAAATGG + Intronic
930499015 2:52187427-52187449 ACCAGGACTCCTTTATGAGTTGG + Intergenic
930508794 2:52318278-52318300 AACAGACCTATTTTATTTTTAGG - Intergenic
931549772 2:63430135-63430157 AACAGTTCTCTCTTATAAGTGGG + Intronic
932858125 2:75260302-75260324 AACACCCCTGCTTTATGAGTGGG + Intergenic
935512972 2:103999277-103999299 AACAGACTTCTTTTATTGTTTGG - Intergenic
937277420 2:120694187-120694209 AACAGACATCTCTTAAGAATAGG - Intergenic
940501023 2:154493858-154493880 AACAGACCTTCCTTATGAATTGG - Intergenic
940689720 2:156900539-156900561 AACAGACATCTTTTTTGGGGAGG - Intergenic
941388370 2:164880935-164880957 AACATAACTCTTTTCTCAGTAGG + Intergenic
942025050 2:171902413-171902435 AATATACCTCTTTTATGGGGAGG + Intronic
943296136 2:186142175-186142197 AACAGACAGCTGTAATGAGTTGG - Intergenic
945651270 2:212563397-212563419 AAAAGACCTTTTTCATAAGTTGG + Intergenic
1170243066 20:14191777-14191799 AACTGACCTCTTTTCTGTTTTGG - Intronic
1174084206 20:47993705-47993727 AAAAGATCTCTGTCATGAGTGGG - Intergenic
1178229126 21:30760932-30760954 CACAGACCTCATTGATGATTTGG - Intergenic
1179384745 21:40931464-40931486 CACAGAGCTCTTTCATGAATGGG - Intergenic
1182310967 22:29406162-29406184 AACACATCTCTTTCATGAGCTGG + Intronic
1184682019 22:46077469-46077491 AAGAGAGCTCTCTTCTGAGTGGG - Intronic
952974269 3:38680839-38680861 TACTGACTTCTTTTATGAGGTGG + Intergenic
954643814 3:52118457-52118479 AACAGAGCTCTATTCAGAGTGGG + Intronic
958045346 3:88278129-88278151 AGCTCACCTCTTTTATGAATAGG - Intergenic
959234279 3:103698456-103698478 AAAAGACCTCTGATATGAGGTGG + Intergenic
960064573 3:113356719-113356741 AACAGAATTATTTTATGAATTGG + Intronic
960097904 3:113705575-113705597 AACAGAGCTCTTGGATGACTAGG + Intergenic
960704814 3:120471873-120471895 AACGGACCACATTTTTGAGTAGG + Intergenic
964029649 3:152122272-152122294 AACATACCTCCTTGATGGGTTGG + Intergenic
965715971 3:171603431-171603453 CACAGACCTGATTTAAGAGTTGG + Intronic
966766308 3:183465594-183465616 AAAAAACCTTTTTGATGAGTAGG - Intergenic
970717653 4:18945585-18945607 AAAAGACCTCTCTTTTGAATAGG + Intergenic
971887841 4:32475981-32476003 AGCAGGCCTCTTATATGAATAGG + Intergenic
977113586 4:92992215-92992237 TCCAAACCACTTTTATGAGTGGG + Intronic
978199768 4:106012290-106012312 AACACACCTCTTTGAAAAGTTGG - Intergenic
980267983 4:130544684-130544706 AGCAGAGCTCTTTTAAAAGTTGG + Intergenic
982577243 4:157129245-157129267 AACAGACCTCTTTTATGAGTGGG - Intronic
990987397 5:61653923-61653945 AACAGCCATCTTTTCTGAGCTGG + Intronic
992730497 5:79662583-79662605 ATCAGAGCTCTTTGATGAGTAGG + Intronic
996483258 5:123999717-123999739 ATCTGGCCTCTTTTATGACTCGG + Intergenic
997911269 5:137876256-137876278 ATCAGACATATTTTATGAGAGGG - Intronic
998675257 5:144400814-144400836 AAAAGACCTCTTTAAGGAGGAGG + Intronic
1004976803 6:20976676-20976698 AAGAGACCTCTATTCTGAATTGG + Intronic
1007284323 6:40736771-40736793 AACAGAGATCTCTTAAGAGTGGG + Intergenic
1013365820 6:109437211-109437233 AACAGGCCTCTTTTCTGAGTGGG + Intronic
1013621345 6:111892954-111892976 AACAGAATTCTTTTATCACTGGG - Intergenic
1021244906 7:18249542-18249564 AACAGATCTGTTTTTTAAGTGGG + Intronic
1021934849 7:25620245-25620267 AACAGATCTTTTTTTTTAGTGGG + Intergenic
1022317687 7:29260773-29260795 ACCGGACCTGTTTTATGAGGTGG + Intronic
1022548769 7:31215904-31215926 AACAGAACTTTTATATGAATTGG - Intergenic
1027252111 7:76405484-76405506 AACATTTCTTTTTTATGAGTCGG + Intronic
1027498760 7:78922066-78922088 AACAGACATGCTTTATCAGTTGG + Intronic
1029161996 7:98559163-98559185 AACATACCTTTGTTTTGAGTTGG + Intergenic
1034730858 7:153386301-153386323 AACAGACCTCTTTTTCCAGCTGG + Intergenic
1035832334 8:2710265-2710287 CTCAGAGCTCTTTTATGAGCTGG + Intergenic
1036086732 8:5620717-5620739 AAAAGACTTTTTTTATGAATTGG - Intergenic
1036687627 8:10922459-10922481 CACAGAGCTCCTTTATGGGTAGG + Intronic
1037292423 8:17365476-17365498 AACATGCCTGTTTTAAGAGTGGG - Intronic
1039359187 8:36857115-36857137 GACACACCTGTTTTATGAGTAGG + Intronic
1039469753 8:37806004-37806026 AGCAGACCTCTTTGAGGGGTAGG - Intronic
1039604935 8:38872463-38872485 AACAGTCAGCTTTTGTGAGTTGG - Intergenic
1045987753 8:108268957-108268979 AACATACCTCTATTGTAAGTTGG - Intronic
1046981154 8:120337565-120337587 AACAGACATCTTTAATATGTAGG + Intronic
1051947219 9:22583380-22583402 AGCAGCCCTCTTTTAGGATTTGG - Intergenic
1056716364 9:89033853-89033875 AAAAGACTTCTTTGATGTGTAGG + Intronic
1188423627 X:30021281-30021303 AACAGAACTCTTTTTTGAAACGG + Intergenic
1192589791 X:72350462-72350484 AACAGGCCTCCTTTTTGTGTTGG + Intronic
1196493587 X:116297084-116297106 AACTGACTTCTTGTATGATTAGG - Intergenic
1196576016 X:117320276-117320298 AATGCACCTCTTTTATGAATAGG - Intergenic
1201617936 Y:15922362-15922384 AACAGAACTATTTTACCAGTAGG + Intergenic