ID: 982578620

View in Genome Browser
Species Human (GRCh38)
Location 4:157149359-157149381
Sequence TTAAGCTATTTCGCCAAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982578619_982578620 7 Left 982578619 4:157149329-157149351 CCTGGAGAATTTTAGGTAAGGAC 0: 1
1: 0
2: 0
3: 17
4: 106
Right 982578620 4:157149359-157149381 TTAAGCTATTTCGCCAAGTATGG 0: 1
1: 0
2: 0
3: 2
4: 85
982578618_982578620 8 Left 982578618 4:157149328-157149350 CCCTGGAGAATTTTAGGTAAGGA 0: 1
1: 0
2: 2
3: 16
4: 192
Right 982578620 4:157149359-157149381 TTAAGCTATTTCGCCAAGTATGG 0: 1
1: 0
2: 0
3: 2
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982578620 Original CRISPR TTAAGCTATTTCGCCAAGTA TGG Intronic
900037546 1:430029-430051 TTAAGCTATTTACTCAAGGAAGG - Intergenic
900765580 1:4502886-4502908 TTAATATATTTCTCCATGTAGGG + Intergenic
904102615 1:28045124-28045146 TAAAGCTAAATCCCCAAGTAAGG + Intronic
906301535 1:44685599-44685621 ATAAGCTATCTGGCCAGGTATGG - Intronic
907745592 1:57209999-57210021 TTAAGTCATTTGGCTAAGTAAGG - Intronic
911154726 1:94626386-94626408 GTAAGCTAATTGGCCAAGTGAGG + Intergenic
911305355 1:96225477-96225499 TTAAGATATATACCCAAGTAGGG + Intergenic
914785568 1:150826266-150826288 TTAAACTATTGCGCCAGGCATGG - Intronic
914955430 1:152157881-152157903 TTGAGCCATTTTGACAAGTACGG + Exonic
918863951 1:189870205-189870227 TTAATATATTTCGCAAAGAATGG + Intergenic
919938172 1:202268587-202268609 GTCAGCTATGTAGCCAAGTAGGG + Intronic
920618187 1:207515922-207515944 TTAAGCAATTGGGCCAAGTGAGG + Intronic
922288745 1:224192761-224192783 AAAAGCTATTTCGCCAGGCACGG + Exonic
922816947 1:228456326-228456348 TTAATCTATTTCTCAAAATATGG - Intergenic
923144621 1:231189334-231189356 CAAAGCTCTTTCGCCATGTAAGG - Intronic
1066415339 10:35216131-35216153 TTAAGCAAATTAGCCAAGCATGG + Intergenic
1076964272 11:67952-67974 TTAAGCTATTTACTCAAGGAAGG - Intergenic
1077779969 11:5316747-5316769 TTCAGGTATTTCTCCAAGGATGG + Intronic
1080632590 11:34092782-34092804 ATAATCTATTTTGTCAAGTAAGG + Intronic
1080654801 11:34250447-34250469 CTAAGCTATTTGGGCAAGGAAGG - Intronic
1092947875 12:13473648-13473670 TTAAGCTCTATCTCAAAGTAAGG + Intergenic
1098090660 12:66897305-66897327 TTAAGCTTTCTCCCTAAGTAGGG - Intergenic
1098423198 12:70326945-70326967 TAAGGCTATTTGGCCAATTAGGG - Intronic
1104278188 12:127350170-127350192 TGAAGCCATGTCTCCAAGTATGG + Intergenic
1106989615 13:35402078-35402100 TTAAACTATTTCCCCAATTTAGG - Intronic
1111974220 13:94948661-94948683 TCAAGCTATTTCGCCATTTCTGG + Intergenic
1117674514 14:58142069-58142091 TTAATCTATTTTGCTGAGTAGGG + Intronic
1121174842 14:91883376-91883398 TAAACCTATTTCACCATGTAGGG + Intronic
1124356887 15:29002385-29002407 TTAAGCGATTTGCCCAAGAAAGG - Intronic
1126571948 15:50162353-50162375 TTAATATATTTCCCCAAATACGG + Intronic
1127452961 15:59134397-59134419 TTAAGCCAGTTGGCCAGGTACGG + Exonic
1132444278 15:101897231-101897253 TTAAGCTATTTACTCAAGGAAGG + Intergenic
1139077443 16:63469519-63469541 TCATGCTCTTTCGCAAAGTAGGG + Intergenic
1140060680 16:71566847-71566869 TTAATAAATTTCACCAAGTATGG - Exonic
1143759888 17:9093516-9093538 TTAAGAAAATTCGCCAAGTGTGG - Intronic
1144575659 17:16427894-16427916 TCAGGCTATTTCCCCCAGTAGGG + Intronic
1145725629 17:27120422-27120444 TTGAGCTTTTTCATCAAGTAGGG + Intergenic
1148387839 17:47247933-47247955 TTAAGCAGTTAGGCCAAGTATGG - Intergenic
1150597119 17:66616001-66616023 CTCAGCCATTTCGCCAAGTGAGG + Intronic
1153753967 18:8261436-8261458 TCAAGCTATTTGGGCAAGTAAGG + Intronic
1153866525 18:9274670-9274692 TTAAATTATTTTTCCAAGTATGG - Intronic
1155326125 18:24666530-24666552 TTTAGCAATTTGGCCAGGTATGG + Intergenic
1160641075 19:137584-137606 TTAAGCTATTTACTCAAGGAAGG - Intergenic
930739674 2:54818202-54818224 TTAGGCTATTTTTCTAAGTAAGG - Intronic
933925221 2:87086131-87086153 TTCATCTCTTTTGCCAAGTAAGG - Intergenic
935242442 2:101190363-101190385 TTCTACTATTTCTCCAAGTATGG - Intronic
940390258 2:153124418-153124440 TTGAGCTTTTTCTCCAAGTTTGG + Intergenic
941204688 2:162557362-162557384 ATAAGCTATTGGGCCAATTAAGG + Intronic
945078457 2:206064319-206064341 TGAATCTATTTTGCCAAGTCAGG + Intronic
948114856 2:235487300-235487322 TGAAGCTCTTTATCCAAGTATGG + Intergenic
1172384008 20:34520394-34520416 GTAAGATATTTGGCCAATTATGG - Intronic
1173573029 20:44090375-44090397 TTCTGCGATTTCGCCAAGTTTGG - Intergenic
1179103656 21:38378801-38378823 TTAAGCTATTTTGCCTCATATGG - Intergenic
956608024 3:71092581-71092603 TTAAGCTTTTTTGGTAAGTAGGG + Intronic
959732474 3:109619648-109619670 ATAAGCTATATTGCCAAGCAAGG - Intergenic
967039638 3:185679063-185679085 TTAATCCATTTAGCCAAGAATGG + Intronic
970675396 4:18442915-18442937 TTTATGTATTTCTCCAAGTATGG - Intergenic
971532417 4:27705517-27705539 TCAAGCTATTTCCCCTAGTCTGG + Intergenic
974129698 4:57738789-57738811 TTATGCCATTCTGCCAAGTAAGG - Intergenic
980252374 4:130334734-130334756 TTAATATAATTTGCCAAGTAAGG + Intergenic
981103020 4:140851222-140851244 TTGAGCTGTTTCTCCCAGTAGGG - Intergenic
982578620 4:157149359-157149381 TTAAGCTATTTCGCCAAGTATGG + Intronic
982580037 4:157164697-157164719 TTAATCTATTCCATCAAGTAGGG + Intronic
983209547 4:164944797-164944819 TGTAACTATTTTGCCAAGTAGGG + Intergenic
990190516 5:53254865-53254887 TAAAGTTCTGTCGCCAAGTATGG + Intergenic
991554055 5:67875561-67875583 AGAAGATATTTCGCCAAGAATGG + Intergenic
991678109 5:69108944-69108966 TTAAGAAATTTCTCCAACTACGG - Intronic
993172164 5:84432411-84432433 TTAAGATATTTAGGCAAGTAAGG + Intergenic
993709950 5:91214640-91214662 TTAAGCTTTATCTCAAAGTAAGG - Intergenic
996664105 5:126037848-126037870 TAAAGCCATTTCTCCAGGTAAGG - Intergenic
999791821 5:154946946-154946968 TTAGGCCCTTTGGCCAAGTATGG - Intronic
999914272 5:156240003-156240025 TTAAGCGAATTGGCCAAGTCGGG + Intronic
1001701174 5:173707535-173707557 TTCAGCACTTGCGCCAAGTAAGG - Intergenic
1002736275 5:181388837-181388859 TTAAGCTATTTACTCAAGGAAGG + Intergenic
1002748422 6:85987-86009 TTAAGCTATTTACTCAAGGAAGG - Intergenic
1013841420 6:114399619-114399641 TTATGCTATTCCTCCAACTATGG + Intergenic
1019241373 6:170664365-170664387 TTAAGCTATTTACTCAAGGAAGG + Intergenic
1028546325 7:92005957-92005979 TTAAGCAATTTGGCCAGGCATGG - Intronic
1035506744 8:143730-143752 TTAAGCTATTTACTCAAGGAAGG - Intergenic
1041847298 8:62344479-62344501 TTAAGCTATCTAGCTAAATAAGG - Intronic
1043473373 8:80582907-80582929 TTAAGCTATTTCAACAGGTGTGG + Intergenic
1045517107 8:102869525-102869547 TTTAGTTATTTTGCCAAGTCAGG + Intronic
1046006504 8:108492770-108492792 TTAAGCTACTTCTGGAAGTAAGG - Intergenic
1052419916 9:28230430-28230452 ATAAACTATTAAGCCAAGTAGGG - Intronic
1203601565 Un_KI270748v1:13599-13621 TTAAGCTATTTACTCAAGGAAGG + Intergenic
1191691943 X:63949000-63949022 TGAAGATATTTCTCCAAGGAAGG - Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic
1201525644 Y:14930715-14930737 GAAAGCTATGTAGCCAAGTAGGG - Intergenic