ID: 982582449

View in Genome Browser
Species Human (GRCh38)
Location 4:157196080-157196102
Sequence GTCCCAAGGTGGAAAATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982582449_982582455 -4 Left 982582449 4:157196080-157196102 CCTCCCATTTTCCACCTTGGGAC No data
Right 982582455 4:157196099-157196121 GGACTTTCAGAGGACCATCCTGG No data
982582449_982582461 27 Left 982582449 4:157196080-157196102 CCTCCCATTTTCCACCTTGGGAC No data
Right 982582461 4:157196130-157196152 AAGTCTAACTGTTTTGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982582449 Original CRISPR GTCCCAAGGTGGAAAATGGG AGG (reversed) Intergenic
No off target data available for this crispr