ID: 982582544

View in Genome Browser
Species Human (GRCh38)
Location 4:157197165-157197187
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982582542_982582544 14 Left 982582542 4:157197128-157197150 CCACAGTTTGACTTGTTTAATAC No data
Right 982582544 4:157197165-157197187 TCCCTTGCCTTGCTAATAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr