ID: 982583485

View in Genome Browser
Species Human (GRCh38)
Location 4:157208413-157208435
Sequence ATTTAGACATAGATGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 287}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982583483_982583485 2 Left 982583483 4:157208388-157208410 CCTGACACATAAACTAAAGACAT 0: 1
1: 0
2: 4
3: 31
4: 311
Right 982583485 4:157208413-157208435 ATTTAGACATAGATGAAGCTGGG 0: 1
1: 0
2: 0
3: 17
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982583485 Original CRISPR ATTTAGACATAGATGAAGCT GGG Intronic
901138278 1:7011628-7011650 AAGTAGACAGGGATGAAGCTGGG - Intronic
901292662 1:8136348-8136370 ATTTCGGCAGAGATGGAGCTTGG - Intergenic
901340909 1:8498398-8498420 ATTTATATATAGTTGAGGCTGGG + Intronic
901966406 1:12871361-12871383 GTAGGGACATAGATGAAGCTGGG + Intronic
902083996 1:13843141-13843163 CTATAGACATACATGAGGCTAGG - Intergenic
902119765 1:14153428-14153450 AAAAAGACATAAATGAAGCTGGG - Intergenic
903420581 1:23215999-23216021 ATTGAGACATCCAGGAAGCTGGG - Intergenic
905160217 1:36026401-36026423 ATTTAAAAACAGATGAGGCTGGG - Intronic
906869837 1:49466068-49466090 ATTCAGATATATATGAACCTGGG - Intronic
907079108 1:51604950-51604972 ATTTATAAAAACATGAAGCTAGG - Intronic
910999288 1:93145470-93145492 ATTAAGACATAGATTGGGCTGGG + Intergenic
911150143 1:94590535-94590557 ATTCAGAAACAGATAAAGCTGGG + Intergenic
912019101 1:105082089-105082111 ATTTACACATACATAGAGCTAGG - Intergenic
915955163 1:160214809-160214831 ATTTAGACAAAGTTCAAGTTAGG + Exonic
916824111 1:168427951-168427973 CTTTAGACATAGATGATGAGGGG - Intergenic
917495147 1:175533844-175533866 AACTAGGCATAGAGGAAGCTTGG + Intronic
917681603 1:177373800-177373822 ATTTAGACATATCAGAAGGTGGG + Intergenic
918777194 1:188648845-188648867 AATTAGACAGAGTTGCAGCTAGG - Intergenic
918820306 1:189245771-189245793 ATTTTGATATAAATGAAGCAGGG - Intergenic
919700341 1:200624859-200624881 ATTTTTACATAAAGGAAGCTTGG + Intronic
920562692 1:206950225-206950247 ATTGAGACATAGACAAACCTTGG + Intergenic
920989089 1:210918998-210919020 ATTTGAACATAGCTGTAGCTTGG - Intronic
921761484 1:218920382-218920404 ATTTTGACTAAGATGAAGGTGGG - Intergenic
921911438 1:220553465-220553487 ATTTAGACATCAATGTAGCAGGG + Intronic
923566928 1:235083340-235083362 ATTTAGACACAGTGGCAGCTGGG + Intergenic
923654811 1:235906449-235906471 AATTAGACAATGATGAAGCCAGG + Intergenic
924479994 1:244421312-244421334 ATTTAAACATAGTTGAACCTAGG - Intronic
1063579695 10:7294453-7294475 ACTTGGAAATAGATGTAGCTGGG - Intronic
1064068165 10:12201545-12201567 ATCTTGACATACAAGAAGCTTGG + Intronic
1066223880 10:33362743-33362765 ATTTTGACAAAAATGAATCTTGG + Intergenic
1069448205 10:68494108-68494130 ATTAAGAAATAGATGGAGTTGGG - Intronic
1070354096 10:75622242-75622264 ATTCAGACATAGACAAAGATGGG + Intronic
1072289367 10:93948408-93948430 ATTTAGACTGAGGTGCAGCTTGG + Intronic
1073260276 10:102184532-102184554 ATAAAGACATACCTGAAGCTGGG + Intergenic
1073958204 10:108896410-108896432 ACTTAGATATAGAGGTAGCTAGG - Intergenic
1076420101 10:130325453-130325475 ATAAAGACATAGCTGAAACTGGG + Intergenic
1078087971 11:8245783-8245805 ATAAAGACATAGCTGAGGCTGGG + Intronic
1078515124 11:12015296-12015318 ATAAAGACATACCTGAAGCTGGG - Intergenic
1079055226 11:17200313-17200335 ATTTAAACATAGGGGAAACTAGG + Intronic
1079780445 11:24595668-24595690 ATTTATAAATAAATGAAGCTAGG + Intronic
1080583482 11:33661980-33662002 ATTTAAAAATATATGCAGCTTGG + Intronic
1080725225 11:34892108-34892130 ATTTAGACTTTGATGAACTTTGG + Intronic
1080727214 11:34910336-34910358 ATTTAGAAGTAAATGAAACTTGG + Intronic
1082990095 11:59200020-59200042 ATAAAGACATAAATGAAACTGGG + Intronic
1086402543 11:86472492-86472514 ATGTAGGCAGAGAAGAAGCTGGG + Intronic
1087222783 11:95564509-95564531 GTTTAGGCACAAATGAAGCTGGG + Intergenic
1087255661 11:95949608-95949630 ATATAGACATACCTGAAGCTGGG + Intergenic
1089382330 11:118044062-118044084 ATTTAGACAGAGATAAATATAGG - Intergenic
1090137963 11:124219264-124219286 AGTGAGAAATAGTTGAAGCTTGG - Intergenic
1090467024 11:126943897-126943919 ATTTAGATATTGATGCAGTTCGG + Intronic
1090692469 11:129198684-129198706 ATAAAGACATACATGAAACTGGG - Intronic
1091128326 11:133122212-133122234 ATATAGACATGGACGGAGCTTGG + Intronic
1091513708 12:1156197-1156219 ATTTACAGGTAGATGAAGATAGG + Intronic
1092652108 12:10646050-10646072 ATAAAGACATACATGAAACTGGG - Intronic
1093129284 12:15370263-15370285 ATTCAGACATAAAGGAGGCTGGG - Intronic
1093316253 12:17654834-17654856 CATTAAACATAGATGAAGCCAGG + Intergenic
1094336134 12:29356332-29356354 CTTTAGACAAAGTTGGAGCTTGG - Intronic
1094787478 12:33865270-33865292 ATTTAGGCACAGATGGAACTTGG - Intergenic
1095131186 12:38544559-38544581 ACTTAGAGCTAGATGGAGCTGGG + Intergenic
1095292525 12:40491811-40491833 ATTTAGACATTGATAAATCTAGG - Intronic
1096914654 12:55018131-55018153 ATTGAGACAAAGATGAGGGTGGG - Intergenic
1097376248 12:58846441-58846463 ATTTGGGCATAGATGGAGGTAGG + Intergenic
1097841204 12:64323220-64323242 ATTTAGACACAGCTGGAACTGGG - Intronic
1099706878 12:86165907-86165929 ATGTTGACATTGATGAAGCCAGG - Intronic
1099997087 12:89789826-89789848 ACTTACATGTAGATGAAGCTAGG + Intergenic
1101164364 12:102012971-102012993 TTTTTAACATAGAAGAAGCTTGG + Exonic
1103053304 12:117799572-117799594 ATTTAATCATAGATGATGCATGG + Intronic
1104806604 12:131593160-131593182 ATTTAGACATAGAACATGCTAGG - Intergenic
1106345751 13:28875919-28875941 ATTTAAACATTGATGAGACTTGG + Intronic
1108219148 13:48215724-48215746 ATTAAGACATACCTGAGGCTGGG - Intergenic
1108421624 13:50256257-50256279 ATTTAAACATGGATGAAGGCAGG - Intronic
1109670138 13:65594417-65594439 ATTAAGACAAAAATGCAGCTGGG + Intergenic
1110351353 13:74511832-74511854 ATTTACAGATTGAAGAAGCTTGG - Intergenic
1110814653 13:79847965-79847987 ATTTAGAAGTAGATTATGCTTGG - Intergenic
1113594878 13:111524060-111524082 AAGTAGCCACAGATGAAGCTAGG - Intergenic
1114158463 14:20134120-20134142 ATAAAGACATACCTGAAGCTGGG - Intergenic
1114333389 14:21660762-21660784 ATTAAAACATAGGTCAAGCTGGG - Intergenic
1114789730 14:25643706-25643728 ATTTAGATTTAGATGGAGCCTGG - Intergenic
1114934562 14:27517239-27517261 ATAAAGACATATATGAAACTGGG + Intergenic
1115070520 14:29317028-29317050 ATTTAAACAAAGAAGAATCTAGG + Intergenic
1115146829 14:30236307-30236329 ATTTAGAGATAGATATAGTTTGG - Intergenic
1115644493 14:35358861-35358883 ATATAGACAAAAATGAGGCTGGG + Intergenic
1115841230 14:37472981-37473003 ATTTAGACACTGCTGTAGCTTGG + Intronic
1116004501 14:39277951-39277973 ATTAAAAAAAAGATGAAGCTGGG - Intronic
1116696379 14:48183230-48183252 TTTTAGCCATAGCTGGAGCTGGG - Intergenic
1118422335 14:65620742-65620764 ATTGAGACTTATATTAAGCTGGG + Intronic
1119150997 14:72359179-72359201 ATAAAGACATACATGAAACTGGG - Intronic
1120973144 14:90226327-90226349 TTTTAGAAATAGCTAAAGCTAGG + Intergenic
1121941276 14:98073327-98073349 ATATAGTCATATAGGAAGCTAGG + Intergenic
1122135954 14:99633162-99633184 ACTGAGACATGGCTGAAGCTAGG + Intergenic
1123903547 15:24899918-24899940 ATTTCCACAGAGATGAATCTGGG + Intronic
1123909577 15:24954109-24954131 ATTTAGACGCTGATGTAGCTTGG - Intronic
1124871805 15:33551061-33551083 AGTTAGACAGAGTAGAAGCTTGG - Intronic
1124895968 15:33777855-33777877 TTTTACACAGAGATGAACCTAGG - Intronic
1125132370 15:36298529-36298551 ATTTAGAAATAAATGAGGTTTGG - Intergenic
1125487470 15:40122296-40122318 TTTTATAAATAGATGAAGTTGGG - Intergenic
1127282447 15:57503631-57503653 ATTAAGACATACCTGAAGCTGGG + Intronic
1127568552 15:60217280-60217302 ATTTACACACAGCTGAGGCTGGG - Intergenic
1128172221 15:65523081-65523103 ATAAAGACATAGCTGAAACTGGG + Intergenic
1128594717 15:68933296-68933318 AGTTAGACATAAATGCAGCTTGG + Intronic
1128820818 15:70651386-70651408 ATTTAGACTTAGATGAACAGTGG + Intergenic
1128866358 15:71117601-71117623 ATTTGGACATGGTTGAAGGTGGG - Intronic
1129610797 15:77054432-77054454 ATATAGATATAGATGAAGGCAGG + Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1133636913 16:7675637-7675659 GATAAGACATAGATGAAGCAGGG - Intronic
1135886840 16:26317759-26317781 ATTTAGTCATTAATAAAGCTAGG - Intergenic
1135934853 16:26771097-26771119 ATCTGGACAGAGATGAAGCCTGG - Intergenic
1140585121 16:76280840-76280862 ATTAAGACATGGTTGAAGATGGG + Intronic
1140811922 16:78586791-78586813 AATTATACATAGATGATACTGGG - Intronic
1140870420 16:79101405-79101427 ATTTACAAATAGATGAAAGTTGG + Intronic
1142618085 17:1148281-1148303 ATTCTGACATCGATGAACCTTGG + Intronic
1146099621 17:29967790-29967812 ATGAAGACATAAAGGAAGCTGGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147641361 17:42002914-42002936 AATTAGTCATAGAGGAAGCAGGG + Intronic
1150184794 17:63169336-63169358 TTGTAGAAATAAATGAAGCTAGG + Intronic
1150371692 17:64644272-64644294 TTTAAGACATAGCTGAGGCTGGG - Intronic
1153502544 18:5763693-5763715 ATTGGGACAGAGATGAAGCAAGG - Intergenic
1154059922 18:11049850-11049872 ATAAAGACATAGCTGAAACTGGG - Intronic
1154291304 18:13110180-13110202 ATTTAGAAATAAATCCAGCTGGG + Intronic
1154516301 18:15169639-15169661 ATATACAAATAGATGAAGATGGG + Intergenic
1156742374 18:40347569-40347591 ATTCAGAGATAGCTGGAGCTGGG - Intergenic
1160107973 18:75995766-75995788 TTTTAGAGATAGAGGAAGATTGG - Intergenic
1160201189 18:76796858-76796880 ATTTAAACATAGTTCAGGCTGGG + Intronic
1162848886 19:13415443-13415465 ATTTAGAACTAGATGAGGCCAGG + Intronic
1162924143 19:13921319-13921341 ATTTAGCCACAGAGGAGGCTGGG + Intronic
1165920718 19:39296414-39296436 ATTTAGCCATGGCTGCAGCTTGG + Exonic
1166206344 19:41272084-41272106 ATGAAGACAGAGATGAAGCAAGG + Exonic
1166925036 19:46261296-46261318 ATTTAGAAAAAGATGGGGCTGGG + Intergenic
925610630 2:5697925-5697947 TTTTAATCATAGATGAATCTTGG + Exonic
925894656 2:8462100-8462122 ATCTAGACAAAAATGGAGCTTGG + Intergenic
926568027 2:14499229-14499251 ATTGAAACATAGATGAATGTTGG - Intergenic
929326805 2:40623335-40623357 GTATACACATAGATGAATCTTGG + Intergenic
929378512 2:41320669-41320691 AATTAAACATAGCTGAAGCTTGG + Intergenic
929560924 2:42955873-42955895 ATGTAGACAAAGATGAAGGAGGG - Intergenic
929892327 2:45928693-45928715 ATCGAGACAGAGATGAGGCTGGG + Intronic
930481272 2:51951698-51951720 ATAAAGACATACATGAGGCTGGG + Intergenic
930519176 2:52441790-52441812 ATCAAGACATAGATGATGATAGG - Intergenic
931430447 2:62205009-62205031 ATTTAGAGATAGCGGAGGCTGGG + Intronic
935269847 2:101424713-101424735 ATAGTGACATGGATGAAGCTGGG + Intronic
937303712 2:120858416-120858438 AAATGGGCATAGATGAAGCTTGG + Intronic
937523422 2:122738613-122738635 ATTTAAACAAAGATGAATTTGGG - Intergenic
939134409 2:138276386-138276408 ATTTATACATACATGAACATAGG + Intergenic
939466156 2:142560576-142560598 ATAAAGACAGAGATAAAGCTGGG + Intergenic
939833986 2:147105682-147105704 ATTTAGACATAGCTAGATCTAGG - Intergenic
940587787 2:155676006-155676028 ATTAAGACATAGAGGAAACTTGG + Intergenic
942383667 2:175419623-175419645 ATCTAGACATAGGTAAAGCTGGG - Intergenic
942552310 2:177132014-177132036 ATATAGCAATAGATGGAGCTTGG + Intergenic
943079729 2:183244113-183244135 ATTTATACATAGATGAATGCTGG - Intergenic
943514963 2:188873899-188873921 ATGTATACATAGATGAAGTGGGG - Intergenic
944392941 2:199237936-199237958 ATAAAGACATAGCTGAAACTGGG - Intergenic
946102962 2:217342867-217342889 ATTAAGAAATAAATGAGGCTGGG + Intronic
946127166 2:217572990-217573012 ATTAAGAAGGAGATGAAGCTAGG + Intronic
946388707 2:219402264-219402286 ATTCTGATATAGATGCAGCTGGG + Intergenic
946467132 2:219921849-219921871 TTTTAGACTCAGATGAACCTAGG + Intergenic
946594403 2:221290174-221290196 ATTTACAGATAGATAATGCTTGG - Intergenic
947127303 2:226882990-226883012 ATTTAGATTTAGATGAAGTTAGG - Intronic
948997077 2:241586738-241586760 AATTAGACACAGATGAAGAAAGG + Intronic
1169516575 20:6322586-6322608 AGTGAGATATAGATGACGCTGGG + Intergenic
1169916504 20:10689093-10689115 ACTAAGTCTTAGATGAAGCTTGG + Intergenic
1169983136 20:11409951-11409973 ATTTAAAAATAAATAAAGCTAGG - Intergenic
1170390863 20:15872621-15872643 ATTTAAACATTTATGATGCTTGG - Intronic
1170754664 20:19189293-19189315 ATTGAAATATAGATGAAGTTGGG + Intergenic
1173136649 20:40444529-40444551 CTTTAGAGAGAGCTGAAGCTAGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1177599380 21:23290204-23290226 ATAAAGACATACATGAAACTGGG - Intergenic
1183471802 22:38012465-38012487 ATCTTAACATAGAGGAAGCTGGG - Intronic
949255825 3:2044651-2044673 AATTAGGCTTAGATGAAGGTAGG + Intergenic
951657885 3:25029499-25029521 ATTTATTCATAAATGAAACTGGG - Intergenic
951743235 3:25947332-25947354 ATTTAGAGATTCATGAGGCTGGG + Intergenic
953226801 3:41028785-41028807 ATTTGGACATAGAAGAAAATAGG - Intergenic
953500324 3:43426857-43426879 AATTAGACATACTTGAAGGTGGG - Intronic
957724208 3:84044035-84044057 ATTTATCCATAGATGGAGGTTGG + Intergenic
959171876 3:102854113-102854135 ATTAAGACATAGCTGAGACTGGG + Intergenic
959371509 3:105532734-105532756 ATTTTGGCATTGATGAAACTGGG + Intronic
960119144 3:113928441-113928463 ATTTAAAAATTGATGAATCTAGG - Intronic
960916353 3:122699037-122699059 ATTTCAACATAGATGGATCTTGG + Intronic
960922749 3:122764325-122764347 AATTTGACAAAGGTGAAGCTAGG - Intronic
961691474 3:128673184-128673206 ATATAGATATATATGTAGCTGGG - Intronic
963126701 3:141823059-141823081 ATTTAGACAAAGAAGAACCAGGG + Intergenic
963372365 3:144417284-144417306 ACTTAGCGATAGATGAAACTTGG + Intergenic
965925007 3:173967404-173967426 CTTTTGAAATAGATGTAGCTAGG + Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970113507 4:12665101-12665123 ATTTAAAAATAGATGAATCCTGG - Intergenic
970469267 4:16360516-16360538 ATGTAGACAGAGTTGGAGCTGGG - Intergenic
970639112 4:18044145-18044167 ATTCAGTCAAAGATGAATCTAGG + Intergenic
971433029 4:26588936-26588958 ATATAGACAAGGATCAAGCTGGG + Intronic
972473474 4:39429348-39429370 CTTTAGAAATAGATGAAGAAGGG - Intronic
973786065 4:54333799-54333821 ATTCAGACATTGCTGAGGCTGGG - Intergenic
974611642 4:64226361-64226383 ACTTAGACCTAGCTGAAGCAGGG - Intergenic
974881233 4:67759869-67759891 ATTAAAACAAAGATGAAGCTTGG + Intergenic
975480732 4:74877170-74877192 ACTAAGACATAGATCAACCTAGG - Intergenic
975602905 4:76121624-76121646 TTTTAAAAATAGATTAAGCTGGG - Intronic
975780806 4:77837925-77837947 ACTTAGACATAAATGAAATTAGG - Intergenic
975880480 4:78900064-78900086 ATTTAGACACAAAAGAAGATAGG - Intronic
976529205 4:86132088-86132110 ATTCATACATATATGAAACTTGG + Intronic
977811827 4:101364739-101364761 ATAAAGACATAGCTGAAACTGGG - Intergenic
977890667 4:102307931-102307953 CTTGAGCCATAGATGAAACTAGG - Intronic
978949190 4:114537125-114537147 ATTTAGAAATAGATCATTCTAGG - Intergenic
979043165 4:115826064-115826086 TTTTAGACAGATATAAAGCTTGG - Intergenic
979660082 4:123243444-123243466 GTTGGGACATGGATGAAGCTGGG + Intronic
979768318 4:124490574-124490596 ATATAGAAATAGATGAAGTGTGG + Intergenic
980842031 4:138275334-138275356 ATTGATATACAGATGAAGCTTGG - Intergenic
981050566 4:140305666-140305688 ATATAGACAGAGAGGAAGGTAGG + Intronic
982583485 4:157208413-157208435 ATTTAGACATAGATGAAGCTGGG + Intronic
984946360 4:184971686-184971708 ATAAAGACATACCTGAAGCTGGG - Intergenic
986118072 5:4800364-4800386 ATTGAGACAAAGATGAAGAGAGG + Intergenic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
987867007 5:23555186-23555208 TTTTAAAGATAGATGAAGCAAGG - Intergenic
988973598 5:36493535-36493557 GTTGAGACATGGATGAAGTTAGG - Intergenic
989796085 5:45474658-45474680 ACTGAGAAGTAGATGAAGCTTGG - Intronic
993526286 5:88969821-88969843 TTTTAGACACAGATGATGGTGGG - Intergenic
994211207 5:97089239-97089261 ATAAAGACATAGCTGAAACTAGG - Intronic
994237927 5:97386796-97386818 ATTTAGAAATAAATCCAGCTGGG - Intergenic
994294380 5:98072158-98072180 ATTTATTCCTAAATGAAGCTGGG + Intergenic
996307067 5:122059507-122059529 ATTTACACATAGATTTTGCTGGG - Intronic
996409043 5:123136962-123136984 AGTTAGAAAGAGATGTAGCTGGG - Intronic
996886790 5:128365733-128365755 ATTTATACATAAATAAAACTTGG - Intronic
997281514 5:132650809-132650831 ATTTTCACAGAGATGAAGTTGGG - Intergenic
997697611 5:135873920-135873942 ATTTAGAGATTCATTAAGCTGGG - Intronic
999558654 5:152774523-152774545 GTAGGGACATAGATGAAGCTGGG + Intergenic
1001011517 5:168103289-168103311 ATGTGGACATAGGGGAAGCTGGG - Intronic
1001435944 5:171699396-171699418 TTTTAGTCATGGATGAAGTTTGG + Intergenic
1003343291 6:5242422-5242444 ATTTAAAAATACATGAGGCTGGG + Intronic
1003880282 6:10474289-10474311 ATAAAGACATACCTGAAGCTGGG - Intergenic
1004326464 6:14678315-14678337 ATTTGGAAATGGATGAACCTTGG - Intergenic
1004885684 6:20049783-20049805 ATTTAGAGAAAAATGAGGCTGGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005055763 6:21727590-21727612 ATTTAGACCTAGCTAAATCTTGG - Intergenic
1005515332 6:26549380-26549402 ATTTAGACATATATCAGCCTGGG + Intergenic
1009281074 6:61752393-61752415 ATTTAGAGTCAGATAAAGCTAGG - Intronic
1010378163 6:75198547-75198569 ATTCAGATATAGATGAAATTTGG + Intronic
1010556585 6:77287844-77287866 ATTTACACATAAATATAGCTAGG - Intergenic
1010712916 6:79196117-79196139 ATAAAGACATACATGAACCTGGG + Intergenic
1012075885 6:94685397-94685419 ATTTAGAAATTCATGCAGCTAGG - Intergenic
1012414334 6:98996567-98996589 AATTATACATATATGAAGGTTGG + Intergenic
1014568690 6:122982551-122982573 ATTAAGAAATATCTGAAGCTGGG - Intergenic
1014892660 6:126861812-126861834 GTAGGGACATAGATGAAGCTGGG - Intergenic
1015824026 6:137292985-137293007 ATATAGACATACCTGAGGCTGGG - Intergenic
1017236439 6:152121505-152121527 ATTTAGACATAGAAGACCCCAGG - Intronic
1018171072 6:161143378-161143400 ATTAAGAAATAGGTGAGGCTGGG - Intronic
1020153625 7:5703281-5703303 ATCTAGAGATGAATGAAGCTTGG - Intronic
1021762737 7:23917250-23917272 AGGTAGTCATATATGAAGCTGGG - Intergenic
1023459029 7:40374545-40374567 ATCTAGACATATATGGAACTAGG + Intronic
1023526883 7:41113769-41113791 ATTTAGGCCTAGATAAAGATGGG - Intergenic
1024424862 7:49213528-49213550 ATAAAGACATAGCTGAGGCTGGG + Intergenic
1025765182 7:64439516-64439538 ATATATACATATATGAAGATTGG + Intergenic
1027253265 7:76412869-76412891 ATGTAAACATTGAGGAAGCTAGG + Intronic
1027497007 7:78900385-78900407 ATTAAGTCAGAGAGGAAGCTGGG - Intronic
1027752340 7:82165261-82165283 ATGTAGATATAAATGAGGCTGGG - Intronic
1028368236 7:90060154-90060176 ATTTACAAATAGATGCATCTGGG - Intergenic
1028754530 7:94420331-94420353 GTTTAGACATTGATGAACCTAGG + Intronic
1029926523 7:104325221-104325243 AGTTAGACAAAGATGGTGCTAGG + Intergenic
1031376486 7:121032950-121032972 CTTTAGATACAGAGGAAGCTGGG - Intronic
1031406988 7:121397386-121397408 ATTTGGAGCTACATGAAGCTAGG - Intergenic
1036437664 8:8749901-8749923 AATTAGACATAGATCCAGCCCGG - Intergenic
1038104674 8:24419099-24419121 ATTTTAACATATATGAAGTTGGG + Intergenic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1039043088 8:33426331-33426353 ATTTAGCCCAAAATGAAGCTGGG - Intronic
1039250405 8:35657916-35657938 ATTTAAATTTAAATGAAGCTTGG + Intronic
1039287374 8:36056808-36056830 ATTTGGACAGACATGAAGCCAGG - Intergenic
1041058627 8:54014295-54014317 ATTTAGAGCTAGGTGATGCTTGG - Intronic
1041336175 8:56787001-56787023 ATTTTAACATAGATTAAGCTTGG + Intergenic
1043714584 8:83466288-83466310 ATATAGACATACCTGAGGCTGGG - Intergenic
1045061199 8:98412737-98412759 TTTTTAACATAGAAGAAGCTCGG + Intronic
1045962674 8:107987052-107987074 ATTTAGGCTTAGAGGAAACTTGG - Intronic
1047615765 8:126561387-126561409 AATAAGACATAGAGGATGCTGGG + Intergenic
1047660919 8:127035725-127035747 ATTTACACATACATGTAGGTAGG - Intergenic
1050087656 9:1983124-1983146 ATTTAATAATGGATGAAGCTAGG - Intergenic
1052593327 9:30527286-30527308 AGTTAGACAAAGAGGAAGCATGG + Intergenic
1052792810 9:32891850-32891872 AATTATACATACATGAAGCTTGG - Intergenic
1053325318 9:37140866-37140888 ATTTAAACATAGAAGGAGATAGG + Intronic
1054740005 9:68796083-68796105 ATTTAGACATAGAAAAAGCCTGG - Intronic
1055722027 9:79185634-79185656 ATTTAGATATAGATATAGATAGG - Intergenic
1055888333 9:81093413-81093435 ATTTAACCAGAGATTAAGCTGGG - Intergenic
1056046474 9:82722761-82722783 AATTACACATAGATTAAGCGCGG + Intergenic
1061770749 9:132919158-132919180 ATCTAGACATATCTGAACCTAGG + Intronic
1186047700 X:5553754-5553776 ATTTAGATATTGAAGAACCTTGG - Intergenic
1186133441 X:6494394-6494416 ATAAAGACATAGATGAGACTGGG + Intergenic
1187597401 X:20788243-20788265 ATTTAGACAGAGAAGAATCAAGG - Intergenic
1187666244 X:21613477-21613499 ATTTACACGTATATGTAGCTTGG + Intronic
1188095484 X:26016130-26016152 ATTTATACATAGTTGAACGTGGG - Intergenic
1188743566 X:33814664-33814686 ATCAAGACATACCTGAAGCTGGG - Intergenic
1189046883 X:37602649-37602671 TTTTATACATAGATGAGCCTGGG + Intronic
1189582080 X:42416929-42416951 ATTTAAAAATAGATGCAACTGGG - Intergenic
1192403273 X:70858619-70858641 TTTTAAACATAGAGGATGCTTGG - Intronic
1192549676 X:72043987-72044009 ATACAGAAATAAATGAAGCTTGG + Intergenic
1194000294 X:88420335-88420357 ATAAAGACATACATGAAACTGGG - Intergenic
1194264426 X:91737679-91737701 ATAAAGACATACATGAAACTGGG - Intergenic
1194862072 X:99011836-99011858 GGTGAGACATAGAAGAAGCTGGG - Intergenic
1195814634 X:108871317-108871339 ATTTAAATATAAATGAAGGTTGG + Intergenic
1196559200 X:117125754-117125776 ATGTAGACATACCTGAGGCTGGG - Intergenic
1196652220 X:118179587-118179609 ATATAGAAAGAGATGGAGCTGGG + Intergenic
1196747804 X:119087206-119087228 ATTTAGACCTATCTGAGGCTTGG + Exonic
1197528427 X:127592004-127592026 ACTTAGACATAGAGGAAACTAGG - Intergenic
1198251777 X:134885973-134885995 ATTTAGACCTAAAGGAAGTTAGG - Intergenic
1198365179 X:135932835-135932857 ATGCAGACTTTGATGAAGCTGGG + Intergenic
1198596011 X:138236575-138236597 GTATGGACATGGATGAAGCTGGG + Intergenic
1199038340 X:143079719-143079741 ATTAAGAAATACATGAGGCTGGG + Intergenic
1199929903 X:152507428-152507450 ATAAAGACATACCTGAAGCTGGG + Intergenic
1201069089 Y:10128068-10128090 ATAAAGACATATCTGAAGCTGGG + Intergenic
1201325586 Y:12754038-12754060 ATTTAAACATAGTGGAAGATGGG - Intronic
1201629775 Y:16058098-16058120 ATTTGAATATAGATGAAGATAGG - Intergenic
1201668520 Y:16488348-16488370 ATTAAGACATATCTGAAACTGGG + Intergenic
1202106955 Y:21381430-21381452 ATTTATACATATATAAAGCATGG + Intergenic