ID: 982584850

View in Genome Browser
Species Human (GRCh38)
Location 4:157222829-157222851
Sequence GGATTGGTGTGGAGGCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982584844_982584850 -1 Left 982584844 4:157222807-157222829 CCAAACAATTAGGGATCTAAAAG 0: 1
1: 0
2: 0
3: 7
4: 152
Right 982584850 4:157222829-157222851 GGATTGGTGTGGAGGCCAGAGGG 0: 1
1: 0
2: 3
3: 27
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982584850 Original CRISPR GGATTGGTGTGGAGGCCAGA GGG Intronic
900651525 1:3732390-3732412 TGCTTGGTGTGGTGCCCAGAGGG + Intronic
900942015 1:5805127-5805149 GGAGTGGTGAGGAGGCCACGTGG - Intergenic
901002543 1:6155756-6155778 GGATGGGGGTGCAGGTCAGAAGG - Intronic
901859321 1:12064007-12064029 GGAGTAGTGGGCAGGCCAGATGG + Intronic
901868219 1:12121693-12121715 GGATTGCTATGCTGGCCAGACGG - Intronic
902160109 1:14523161-14523183 GGGTTGGTGAGGATGCCAGTGGG - Intergenic
903178237 1:21593057-21593079 GGATTGGGGTGGAGGAGAGGTGG + Intergenic
903797514 1:25940902-25940924 GCATTGGGGTGGAGCTCAGAAGG + Intergenic
904489678 1:30850610-30850632 AGGATGGCGTGGAGGCCAGATGG - Intergenic
905432492 1:37934721-37934743 GGTGTGGTGTGGACCCCAGAAGG + Intronic
905868472 1:41389281-41389303 TGATTGGTGTGCAGGTCAAATGG - Intergenic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
906810805 1:48825202-48825224 GAATTGCTGCGGAGGCCAGGAGG + Intronic
908329727 1:63059273-63059295 GCATGAGTTTGGAGGCCAGATGG - Intergenic
910984927 1:92996119-92996141 GGATTGCTGTGGAAGGAAGAAGG + Intergenic
914718078 1:150267924-150267946 GGAGTGGTCTGGAGGGGAGAGGG - Intronic
916932703 1:169595784-169595806 GGATTGGTGTGGATTTCATAAGG + Intronic
917040634 1:170802596-170802618 AGATTGATGTGGTGGCTAGAGGG + Intergenic
917567627 1:176229499-176229521 CCATTGGTGTGGAGCACAGAGGG + Intergenic
917967510 1:180187770-180187792 GCAGTGGGGTGGAGGACAGAGGG + Intronic
918134731 1:181661450-181661472 GGTTTGGTGTGGAAATCAGAGGG + Intronic
918225024 1:182473593-182473615 TGATTGGTTGGGATGCCAGATGG - Exonic
919064007 1:192669279-192669301 TCACTGCTGTGGAGGCCAGAAGG + Intergenic
919406248 1:197187863-197187885 GGGTTGGTGTGGGAGACAGATGG + Intronic
919977592 1:202623026-202623048 GGCTTGGTGGGGTGGCCTGAGGG - Intronic
920254462 1:204644972-204644994 AGATAGGTGTGGAATCCAGATGG - Intronic
920551710 1:206867095-206867117 GGGGTTGTGGGGAGGCCAGATGG + Intronic
921091832 1:211850719-211850741 TGATTTCTGTAGAGGCCAGATGG + Intergenic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
923434705 1:233956925-233956947 GGATAGGGGTAGAGGCCAAATGG + Intronic
923790313 1:237106039-237106061 ACAGTGGTGGGGAGGCCAGAGGG + Intronic
924451923 1:244186556-244186578 TGAGTGGGGTGGAGGCCAGGAGG - Intergenic
1063097533 10:2921603-2921625 GAAATGGTATAGAGGCCAGAGGG - Intergenic
1063623359 10:7667623-7667645 GGGCTGGTGTGGGGGCCACAGGG - Intergenic
1064156211 10:12905442-12905464 GGATGGGTTTGGAGGGCAGCTGG + Intronic
1065935183 10:30514973-30514995 TGTTTGGTCTGGAGGCCAGGAGG - Intergenic
1067142645 10:43669632-43669654 GGCTTGGTGAGCAGCCCAGAGGG + Intergenic
1067972017 10:50982979-50983001 GGAGTGGTGTGAAGACCAGATGG - Intergenic
1070555433 10:77523810-77523832 GGATTGGAGGGGAGGCAGGATGG + Intronic
1072614167 10:97038426-97038448 TGAGTAGAGTGGAGGCCAGAAGG - Intronic
1072621428 10:97081913-97081935 GGTTTGATGTGTGGGCCAGATGG - Intronic
1073083705 10:100875226-100875248 GGAGAGATCTGGAGGCCAGAGGG - Intergenic
1076988928 11:259145-259167 GGGGTGGGGTGGAGGGCAGAGGG - Intergenic
1078137253 11:8661764-8661786 TGAGTGCTGTGGAGGCCAAAAGG - Intronic
1078456214 11:11477495-11477517 GGAAAGGTGTGGAGGGCAGGAGG - Intronic
1078859158 11:15231245-15231267 GAAGTGGTGTGGAGGGAAGAGGG + Intronic
1079764920 11:24380323-24380345 GGATTTTTGGGGAGGGCAGAGGG - Intergenic
1080951349 11:37036767-37036789 GCAATGGTGTGTAGGCTAGATGG + Intergenic
1081695706 11:45107686-45107708 GGATTGGTGTGAAAGCAACACGG - Intronic
1081704106 11:45170680-45170702 GGTTTTGAGTGGAGGGCAGAGGG + Intronic
1083330114 11:61893497-61893519 GGATCACTGTGGAGGCCAGGCGG + Intergenic
1083410548 11:62489597-62489619 TGACTGGTGTGGTAGCCAGATGG + Intronic
1083431099 11:62613806-62613828 GGATTGGTTTGGGGTCCAGTGGG + Exonic
1083862312 11:65427999-65428021 GGATTGGAGTGGAGGCAAGGAGG - Intergenic
1084075339 11:66770797-66770819 CGATGGGTAAGGAGGCCAGAAGG - Intronic
1085319485 11:75565192-75565214 GGCTTGGGGAGGAGGCCTGAGGG + Intronic
1086605905 11:88696107-88696129 AGATGGATGGGGAGGCCAGAAGG + Intronic
1086866589 11:91987022-91987044 GGATTGGGGTGGAGTGCAGTGGG - Intergenic
1089077392 11:115749237-115749259 GAAATGGAGTGGAGACCAGAGGG - Intergenic
1089129965 11:116203700-116203722 GGAGTGGTGTGGAGGTGTGAGGG + Intergenic
1089133750 11:116232990-116233012 GCAAAGGTATGGAGGCCAGAAGG - Intergenic
1090274378 11:125409294-125409316 GGAATGGTGAGGAGAGCAGAGGG + Intronic
1090830915 11:130420340-130420362 GGCTTGGAGAGAAGGCCAGATGG + Intronic
1090888149 11:130897620-130897642 GGATTGGTGTGGAGTCCTGATGG - Intronic
1091312317 11:134583407-134583429 GGCTTTGTGTGGGGGCGAGATGG + Intergenic
1091635058 12:2190789-2190811 GGATTGGTGGGGTGGCAAGAAGG + Intronic
1092698346 12:11199453-11199475 TGCTTGGTGAGGAGGTCAGATGG - Intergenic
1096152977 12:49326003-49326025 GGGTTGGTGGTGAGGCCTGAGGG + Intronic
1096331646 12:50718418-50718440 GGATTGGGGTGGAGGGAAGGAGG - Intronic
1099296159 12:80830700-80830722 GGATTGGAGTAGAGGGGAGAAGG - Intronic
1099871629 12:88356628-88356650 GGACTGGTGTGGGGGAGAGATGG - Intergenic
1100351851 12:93791520-93791542 GGGTTGGGGTGGAGGGCAGGTGG + Intronic
1103699699 12:122842712-122842734 GGCCTGATGTGGAGTCCAGATGG - Intronic
1104116603 12:125755001-125755023 GGATTTGTGTGCAAGCCGGAGGG + Intergenic
1104325729 12:127795479-127795501 GGATTTGTGTGGTGACCAGGCGG - Intergenic
1106057156 13:26249135-26249157 GTATAGGAGAGGAGGCCAGAGGG - Intergenic
1109156368 13:58915079-58915101 TGATTGATGTGGAGTCAAGAGGG + Intergenic
1113421165 13:110172576-110172598 GGATGGGTGCTGAGCCCAGAGGG - Intronic
1113935113 13:113989771-113989793 GGATGGGTGTGCTGGACAGATGG - Intronic
1114326849 14:21598028-21598050 GGATTTGTGTGGGGGGCGGAGGG - Intergenic
1115739427 14:36372588-36372610 GGAGGGGTGGGGAGACCAGAAGG - Intergenic
1116064558 14:39966424-39966446 TGATTGGTGTGGGGTTCAGAGGG + Intergenic
1118466106 14:66032598-66032620 GGTTTGGGGTGGAGCCAAGATGG - Intergenic
1120115279 14:80609459-80609481 GGATGGGGGTGGGGGCCAGAGGG - Intronic
1120389184 14:83883742-83883764 GGTTGGGAGTGGAGGCTAGATGG - Intergenic
1121452739 14:94019714-94019736 GCACTGGCGCGGAGGCCAGAGGG + Intergenic
1122295513 14:100703559-100703581 GGGCTGCTGTTGAGGCCAGACGG + Intergenic
1122403020 14:101478672-101478694 GGGTGGGTGTGGGGGCCAGGCGG - Intergenic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1123751906 15:23363651-23363673 GGGTGGGGGTGGTGGCCAGAGGG - Intronic
1124018005 15:25894449-25894471 GGGTTGGTGGGGAGGGCAGCAGG - Intergenic
1124284272 15:28387575-28387597 GGGTGGGGGTGGTGGCCAGAGGG - Intronic
1124298425 15:28524039-28524061 GGGTGGGGGTGGTGGCCAGAGGG + Intronic
1124970074 15:34479972-34479994 GGGTTGGTGGGGAGGGGAGAGGG - Intergenic
1126688488 15:51268249-51268271 GGATGGGTGTGGAGGAAGGATGG - Intronic
1128748562 15:70132267-70132289 GTATTGGTGTGGAAGCCAGCTGG + Intergenic
1129413612 15:75362757-75362779 GGAGTGAGGTGGAGGACAGAGGG + Intronic
1130181599 15:81634894-81634916 GTATTGGTCTGGAGGCCGGGGGG + Intergenic
1131321069 15:91391775-91391797 GGATTGGCTTGAAGGACAGATGG - Intergenic
1132353379 15:101154454-101154476 GGGTTGGTGAGGAGTGCAGATGG + Intergenic
1132358192 15:101189252-101189274 GCACGGGCGTGGAGGCCAGAGGG - Intronic
1132515517 16:364117-364139 TGATTGGTGAGGATGGCAGAAGG + Intergenic
1134502410 16:14779611-14779633 GGGCTGGTGTGGAAGCCAGAGGG + Intronic
1134578154 16:15349283-15349305 GGGCTGGTGTGGAAGCCAGAGGG - Intergenic
1134724437 16:16408263-16408285 GGGCTGGTGTGGAAGCCAGAGGG + Intergenic
1134942994 16:18303596-18303618 GGGCTGGTGTGGAAGCCAGAGGG - Intergenic
1135842919 16:25893099-25893121 GGAATGGTGTGCAAGGCAGAAGG + Intronic
1137563207 16:49516145-49516167 GGCATGGAATGGAGGCCAGAGGG - Intronic
1138098177 16:54230105-54230127 GGATTGGTGAGGAGGGGAGTGGG + Intergenic
1138548834 16:57736044-57736066 GGGTCGGGGTGGAGGCCGGAGGG + Intronic
1139347429 16:66313119-66313141 GGATTGATGGAGATGCCAGAGGG + Intergenic
1143561288 17:7696784-7696806 GCACTGGTGTGGAGTCCAGGAGG + Intronic
1144572222 17:16407349-16407371 GGATTCGTGGGGAAGCGAGAGGG + Intergenic
1144659455 17:17058626-17058648 GCCTTGGTGAGGAGGCCAGGAGG - Intronic
1146148353 17:30442872-30442894 GGATATGTGTGGTGGCCAGTAGG + Intronic
1147109979 17:38255221-38255243 GCATTGGTGTGAAAGCAAGAGGG - Intergenic
1147615084 17:41822838-41822860 GGATTGGGGAGGAAGGCAGAGGG - Exonic
1147916472 17:43890512-43890534 GGGTTGGAGTGGAGGGCAGAGGG - Intronic
1148178136 17:45585045-45585067 GGCCGGGTGGGGAGGCCAGAGGG + Intergenic
1148445614 17:47735147-47735169 GGCTTGGGGTGGAGGGGAGAGGG + Intronic
1150023060 17:61640262-61640284 GGCTTGGAGGGGAGGCCAGAAGG + Intergenic
1150408033 17:64919335-64919357 GGCCGGGTGGGGAGGCCAGAGGG + Intronic
1150805576 17:68316210-68316232 GTATTTGAGTGGAGGCCAGAAGG - Intronic
1150884055 17:69064610-69064632 GGTTTGGGGTGGAGGGGAGATGG + Intergenic
1151499832 17:74481587-74481609 GGAGTGGGGTGGAGGCAGGAAGG + Intronic
1152200858 17:78945080-78945102 GGATATCTGTGGAGGCCAGCGGG - Intergenic
1154394474 18:13974526-13974548 GGTGTGGTGTGGAAGCCAGGAGG + Intergenic
1154470367 18:14694146-14694168 GAATTGGTGTGGATCCCAGCGGG - Intergenic
1156508429 18:37614438-37614460 AGATTGGGGTCGAGGGCAGAGGG + Intergenic
1156932277 18:42660315-42660337 GCATTGGGGTGGAGCCAAGATGG + Intergenic
1160744285 19:703583-703605 GGGTTGGGGTGGGGGCCATAAGG + Intergenic
1161028812 19:2048670-2048692 GGAGATGGGTGGAGGCCAGAGGG + Intronic
1163491664 19:17620498-17620520 GGGTTGGTGGGTAGGGCAGAGGG - Intronic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1165896476 19:39144545-39144567 GGTTTGTTCTGGAGGCCAGAAGG + Intronic
1166331374 19:42079860-42079882 GGACTGGTGTTGTGGGCAGAGGG - Exonic
1167492606 19:49801162-49801184 GGATTGGGGTGGAGGCCGAGAGG - Intronic
1168030073 19:53672574-53672596 GGACTGGTATGGGGGGCAGAAGG - Intergenic
1168435688 19:56315218-56315240 CGATTGGTGAAGAGGCCACATGG + Intronic
925157659 2:1659994-1660016 GGAGTGGGGTGATGGCCAGAGGG + Intronic
925505100 2:4553858-4553880 GGCTTTGTGTAGAGGGCAGAGGG - Intergenic
926351448 2:11998935-11998957 TGGTTGGTGTGCAGGCCAGGGGG + Intergenic
926736538 2:16077770-16077792 GGCTTGGCATGGAGGCCAGATGG - Intergenic
929281118 2:40080206-40080228 GGATTGTTTTGCAGGCAAGAGGG + Intergenic
929763612 2:44826212-44826234 AGATTTGTCTGGAGGGCAGAAGG - Intergenic
929895864 2:45960454-45960476 GGAGTGGTGTGGGGGGCAGAAGG + Intronic
933547202 2:83729690-83729712 GGCTAGGTGTGGAGGCCAGAAGG + Intergenic
933881302 2:86672739-86672761 GGAATGGTGTGGATTCCAGGTGG + Intronic
936278517 2:111119891-111119913 GGATGGGTGGGGAGGCGGGAGGG + Intronic
936410544 2:112254635-112254657 GGAGCGGGGTGGAGGCGAGAAGG - Intronic
937050164 2:118882078-118882100 GGATTGGGGAGGTGGGCAGATGG + Intergenic
937098378 2:119250296-119250318 GGGGCGGTGTGGAGGCCTGAAGG + Intronic
937202059 2:120210090-120210112 GGCTTGGTGTGGAGAGAAGAAGG + Intergenic
937921249 2:127133219-127133241 GGTCCTGTGTGGAGGCCAGAGGG - Intergenic
937952338 2:127398201-127398223 AGATTGTGGTGGAGGCCAGCAGG + Intergenic
938306398 2:130259177-130259199 GGCTTTGTGTGGAGCCAAGATGG + Intergenic
938605625 2:132889904-132889926 TGAGTGGTGTGGAGGAAAGAAGG + Intronic
938675730 2:133632067-133632089 GGATTGGAGTGGAAGGCTGAAGG + Intergenic
938939901 2:136161054-136161076 TGATTGGCGTGGAGGGAAGATGG + Intergenic
939026408 2:137019170-137019192 GGATTGGAATGGAGGCGAGTGGG - Intronic
940144887 2:150535551-150535573 GGATTATTGTAGTGGCCAGAGGG - Intronic
944353486 2:198758020-198758042 GAAATGGTATGGAGCCCAGATGG - Intergenic
944665212 2:201953984-201954006 GGGTTGGGGTGGGAGCCAGATGG - Intergenic
946311749 2:218885772-218885794 GGATTGGGGTGGTGCTCAGATGG + Intronic
947524122 2:230868217-230868239 GGATGGGGGTGGGGGCCAGCTGG + Intronic
948384745 2:237574583-237574605 GGGTTGGGGAGCAGGCCAGATGG - Exonic
1169032129 20:2417624-2417646 GGAGGGTTGTGGAGGTCAGAGGG + Intronic
1169208461 20:3752905-3752927 GGGTGGATGGGGAGGCCAGAGGG + Exonic
1169668237 20:8064184-8064206 GGATTGGGGCAGAGGGCAGAAGG + Intergenic
1170891873 20:20382754-20382776 GGATTGTTGTGAAGGCCAAATGG - Intergenic
1172421781 20:34824941-34824963 GGATTGGGGTGGAGGCATGGGGG - Intronic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173984465 20:47250374-47250396 GGGTTGGAGGGGATGCCAGAGGG - Intronic
1175146339 20:56899150-56899172 GCATTGGTGGGAAGGCAAGAAGG + Intergenic
1175509356 20:59512666-59512688 GGATTGGAGTGGAGGACACAGGG - Intergenic
1179551759 21:42147789-42147811 GGAGTGGAGTGGACACCAGAGGG + Intergenic
1181419092 22:22785607-22785629 GCAGGGGTGTGGAGGCCAGGGGG - Intronic
1181475882 22:23167489-23167511 GGAGTGGAGAGGAGGCCAGCAGG + Intergenic
1182031298 22:27161327-27161349 GCATTGCTGGGGAGGACAGAAGG + Intergenic
1182071570 22:27467229-27467251 GGGTTGGGGTGGTGGCCAGCGGG + Intergenic
1183648191 22:39138812-39138834 GGATTGGTGGGCAGGCCTGTGGG - Intronic
1184415167 22:44347989-44348011 GGATTAGAGTGGGGGCCAGGAGG - Intergenic
1184645299 22:45891899-45891921 GGCCTGGTGTGGGGGCCACAGGG - Intergenic
1184695206 22:46135135-46135157 TCACTGGTGTGGAGGGCAGAGGG + Intergenic
1185212821 22:49581419-49581441 GGATTGGCATGGGGGCAAGATGG + Intronic
949677571 3:6474155-6474177 GGATTGATGTGAAGATCAGATGG + Intergenic
953389778 3:42527461-42527483 GGATAGCTGTGGCGACCAGAAGG - Exonic
953699341 3:45183903-45183925 GGGTTGGGGTGGAGGGCAGTGGG + Intergenic
953830110 3:46289709-46289731 AGATGGGTGTGGAGAGCAGAGGG + Intergenic
960731353 3:120731230-120731252 GCATTGGTGTGCAGGAGAGAGGG - Intronic
961378112 3:126480448-126480470 GGCTTGGTATGGAGCCCAGAGGG + Intergenic
962358518 3:134715474-134715496 GGGATGGTGTTGATGCCAGAAGG + Intronic
962947557 3:140185667-140185689 GGATGGGGGTGCAGGGCAGATGG + Intronic
965106569 3:164363058-164363080 CGAGTGGAGTGGAGGGCAGACGG + Intergenic
966627683 3:182036324-182036346 ATATTGGTTTGGAGGCCACATGG - Intergenic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967853759 3:194101107-194101129 GGACAGGTGTGGTGGCCACAGGG + Intergenic
968579077 4:1381367-1381389 GTATGGCTGAGGAGGCCAGAGGG - Intronic
972611498 4:40659816-40659838 GGATTGGAGTGGAAGGGAGATGG - Intergenic
973386245 4:49516080-49516102 GGCTTGGTGTGGAGCCCTCACGG - Intergenic
974318727 4:60315624-60315646 GGATTAGTAAGGAGGCCTGATGG + Intergenic
974547622 4:63333598-63333620 GGTTGGGTGTGGAGCCAAGATGG + Intergenic
975655363 4:76635969-76635991 GAATTGGTTTGGAAACCAGAAGG - Intronic
976409387 4:84695651-84695673 GGTTTTGTCTGGAGGCCAGTGGG - Intronic
979302542 4:119103304-119103326 GGCTTTTTGTGAAGGCCAGATGG - Intergenic
982240716 4:153296636-153296658 GGGTTGGGGTGGAAGCAAGAAGG + Intronic
982584850 4:157222829-157222851 GGATTGGTGTGGAGGCCAGAGGG + Intronic
983577089 4:169271237-169271259 GGATTGGGGCGGCGGCCTGAGGG + Intergenic
984993829 4:185408648-185408670 AAATTGGAGAGGAGGCCAGAAGG - Intronic
989111854 5:37914155-37914177 GGAGTGGGGTGGGGGGCAGAGGG + Intergenic
990302177 5:54460021-54460043 GGATCTGACTGGAGGCCAGAGGG + Intergenic
997408922 5:133675413-133675435 GGCCTAGTGTGGTGGCCAGAAGG + Intergenic
998570193 5:143250217-143250239 TGGTTGGGGTGGAGGCCAGCAGG - Intergenic
999619789 5:153461007-153461029 AGATTGGAGGGGAGGCAAGATGG + Intergenic
1001450111 5:171818065-171818087 TTATTGGTGTAGTGGCCAGAAGG - Intergenic
1003307077 6:4939265-4939287 GGATTGGTGTGGTGGGTAGGGGG + Intronic
1003578821 6:7321014-7321036 GGATGGGAATGGAGGCCAGACGG + Intronic
1003691165 6:8355029-8355051 GGATGGGTTTGGAGTTCAGAAGG + Intergenic
1003741864 6:8949719-8949741 GCATTGAAGTGGGGGCCAGATGG + Intergenic
1004006955 6:11645794-11645816 GCACTGGTGGGGAGTCCAGAGGG + Intergenic
1004746196 6:18511230-18511252 AGATGGATGGGGAGGCCAGAAGG - Intergenic
1005490630 6:26344077-26344099 GGTATGGTGAGGAGTCCAGATGG - Intergenic
1005532270 6:26720068-26720090 GGATAGGTGTGCAGGCATGATGG - Intergenic
1005538525 6:26781597-26781619 GGATAGGTGTGCAGGCATGATGG + Intergenic
1006456862 6:34136941-34136963 GGGTTGGGGTGGGGGCCAGGCGG + Intronic
1006596018 6:35192863-35192885 GGATGGGACTGGAGGCCAGGAGG - Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1009009377 6:57823834-57823856 GGATAGGTGTGCAGGCATGATGG + Intergenic
1009295746 6:61944495-61944517 GGAAGGGTGTGAAGGTCAGAGGG + Intronic
1009406506 6:63320450-63320472 GAATTAATTTGGAGGCCAGAGGG - Intergenic
1009782006 6:68283869-68283891 ACATTGGTGTGGAGCCAAGATGG + Intergenic
1010954206 6:82071559-82071581 GGACTGTTGTGGGAGCCAGAAGG + Intergenic
1012316659 6:97789753-97789775 GGATAGGTAGGGAGGCCAGCAGG - Intergenic
1017359181 6:153545973-153545995 GGGGTGGTGGGGAGGGCAGAAGG - Intergenic
1020590889 7:10135579-10135601 TGATTGGTGTGGAGAGCAGGAGG - Intergenic
1021488330 7:21191099-21191121 GGAGTAGGGTGGAGGGCAGATGG + Intergenic
1022813649 7:33893469-33893491 GGGTAGGTATGGAGGCTAGAAGG - Intergenic
1023554218 7:41403447-41403469 GGGTTGGTTTGCAGGCCAGAGGG - Intergenic
1024729505 7:52238812-52238834 GGAAGGGTGGGGAGGACAGAGGG - Intergenic
1025261984 7:57425850-57425872 GGCTCGGTGTGGGGGCCAGACGG - Intergenic
1025615463 7:63113435-63113457 GGTTTGGTGTGGGGACCAGCCGG + Intergenic
1027361099 7:77411144-77411166 AGATTGATTTGGGGGCCAGAGGG - Intronic
1027807937 7:82853302-82853324 AGAATGGTGAGGAGGCTAGAAGG - Intronic
1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG + Intronic
1033644058 7:143287658-143287680 GGGTTGGTATGAAGGCCAGAAGG + Exonic
1038498426 8:28023783-28023805 GGATTGGGGTGGGGGGAAGAGGG - Intronic
1038798699 8:30730629-30730651 GGATTAGAGGGGAGCCCAGAAGG + Intergenic
1039322826 8:36451653-36451675 AGATTGGTGTGAAGATCAGAAGG - Intergenic
1039407268 8:37324084-37324106 GCATGGGTGTGGAGGCCAAGAGG + Intergenic
1039512497 8:38103222-38103244 GAATTTGTGTGGAGGCATGATGG + Intergenic
1039672728 8:39620860-39620882 GGATGGGTGAGGAGGTGAGAGGG + Intronic
1039829338 8:41200568-41200590 GGATGGGGGTGAGGGCCAGAAGG - Intergenic
1039853920 8:41396562-41396584 AGCTTGGTGTGGAGGCCTTAGGG + Intergenic
1040850763 8:51898832-51898854 GGATGCGCTTGGAGGCCAGAGGG - Intronic
1043511765 8:80957215-80957237 GCTGTAGTGTGGAGGCCAGAAGG - Intergenic
1044142074 8:88668792-88668814 GTGTTCATGTGGAGGCCAGAGGG + Intergenic
1045622761 8:104001678-104001700 GGATTGGGATGGAGGTCAGAGGG - Intronic
1047601189 8:126427212-126427234 GGATTGGTGTGGTGGGAAGAGGG + Intergenic
1047871649 8:129089548-129089570 GGATTGGTATGGAATCAAGAGGG + Intergenic
1048000865 8:130378557-130378579 GGATTGGAGCTGAGGTCAGACGG + Intronic
1050114847 9:2253106-2253128 GGTCTGCTGGGGAGGCCAGATGG - Intergenic
1051082162 9:13306669-13306691 GGATGGGGGTGGAGCCAAGATGG - Intergenic
1051213132 9:14766593-14766615 GGATTCCTGTGGAGTCCTGAAGG - Intronic
1054254169 9:62748066-62748088 CTATTGGTATGGAGGACAGAAGG - Intergenic
1054568234 9:66782236-66782258 CTATTGGTATGGAGGACAGAAGG - Intergenic
1056733015 9:89181987-89182009 GGGTTGGTGAGGAGGTCAGGAGG + Intergenic
1056930632 9:90873655-90873677 GCATTGGGGTGGATGGCAGAGGG - Intronic
1058066530 9:100554606-100554628 GGGCTGGTGTGGAGGACAGTGGG + Intronic
1058755210 9:108077327-108077349 GGCATGGTGTGGAGGCAGGAGGG + Intergenic
1058814952 9:108674623-108674645 GGACAGGTGAGGAGGCCAGAGGG - Intergenic
1061642404 9:131969627-131969649 GGATTGGAGAGGGAGCCAGATGG + Intronic
1061800000 9:133108643-133108665 GGACTGGGGTGGGTGCCAGAGGG - Intronic
1061907751 9:133707580-133707602 GGATGGGCGGGGAGGCAAGAGGG - Intronic
1062494893 9:136827025-136827047 GGGCTGGTGTGGAGGCCTGTGGG + Intronic
1185525448 X:774884-774906 TGCTTGTTGAGGAGGCCAGAAGG + Intergenic
1185672870 X:1825967-1825989 GTATTGGTGTTGAGGCCGGGTGG - Intergenic
1187602248 X:20845440-20845462 GGATGGGGGTGGAGCCAAGATGG + Intergenic
1189160004 X:38801663-38801685 GGGGAGGGGTGGAGGCCAGAAGG + Intronic
1192607246 X:72531093-72531115 TGATTGGTGATGAGGCTAGAAGG + Intronic
1194970792 X:100341341-100341363 GGTTTTGTGTGGAAGCTAGAGGG + Intronic
1196613775 X:117743675-117743697 GCCTGGGTGTGGAGTCCAGAGGG - Intergenic
1197755085 X:129987741-129987763 GGCTTGGACTGGAGGCCACATGG + Intronic
1199580061 X:149351850-149351872 AGATGGATGAGGAGGCCAGAAGG + Intergenic
1199847582 X:151702152-151702174 GGTTTGGTGTTGAGGTCAGGAGG - Exonic
1200216222 X:154369325-154369347 GGACTGGGGTGGGGGCCTGATGG - Intronic
1201121516 Y:10877081-10877103 GGAATGGAGTGGAGGGCAGTGGG - Intergenic
1201564899 Y:15355504-15355526 GGAAGAGGGTGGAGGCCAGAGGG - Intergenic