ID: 982584872

View in Genome Browser
Species Human (GRCh38)
Location 4:157222927-157222949
Sequence CAGGAAATGATGGCAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 305}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982584872_982584874 -8 Left 982584872 4:157222927-157222949 CCAGCAGCTGCCATCATTTCCTG 0: 1
1: 0
2: 1
3: 43
4: 305
Right 982584874 4:157222942-157222964 ATTTCCTGCCGACTGCCCTGCGG 0: 1
1: 0
2: 2
3: 7
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982584872 Original CRISPR CAGGAAATGATGGCAGCTGC TGG (reversed) Intronic
900581473 1:3411896-3411918 CAGGGCACGACGGCAGCTGCGGG + Exonic
900758028 1:4451098-4451120 CAGGAATGGATGGGAGCTCCAGG - Intergenic
900979784 1:6039795-6039817 CAGGAACTGAGGGCAGCCTCGGG - Intronic
901049065 1:6417227-6417249 CAGGATATGAAGGAAGCTGTAGG - Exonic
901151880 1:7109027-7109049 CAGGAACTGAGGGCAGCCTCTGG - Intronic
901461207 1:9392877-9392899 CAGGAAATGACAGCACCTTCGGG + Intergenic
902750567 1:18506695-18506717 CAAGGAATGAAGGCAGCTTCTGG - Intergenic
903907418 1:26696545-26696567 GGGGAAATGAAGGCAGCCGCCGG + Exonic
904495063 1:30881914-30881936 CAGGGGGTGAGGGCAGCTGCGGG - Intronic
905449841 1:38048826-38048848 AGGGAGATGATGGCAGCTCCAGG - Intergenic
905479085 1:38248889-38248911 CAGGAGATGTGGGCAGGTGCGGG - Intergenic
906098900 1:43243400-43243422 AAGGGATTGATGGCAGCTGCAGG + Intronic
907863035 1:58372148-58372170 CAGGCAATGAAAGCAGCTGCAGG + Intronic
909566274 1:77056792-77056814 CATGAACTGTGGGCAGCTGCAGG + Intronic
909931274 1:81502736-81502758 CAGCAATTGATGGCAACCGCAGG + Intronic
910098497 1:83551436-83551458 CAGGAAATAATCGCATCAGCTGG - Intergenic
911277434 1:95879292-95879314 CAGGCCATGAAAGCAGCTGCAGG - Intergenic
913061630 1:115213981-115214003 AAGGAACTGATTGCAGCTGCTGG + Intergenic
914379217 1:147101340-147101362 ACAGACATGATGGCAGCTGCTGG + Intergenic
914973910 1:152339964-152339986 AAGAAAATGATGGCTGCTGATGG + Intergenic
915281092 1:154822677-154822699 CAGGAGATGAGAGCAGCTGCCGG - Intronic
915531529 1:156505030-156505052 CAGGATGTGGTGGCAGCTGCAGG + Intergenic
915637019 1:157194733-157194755 AAGGGGATGATGGCAGCGGCGGG + Intergenic
915675585 1:157526969-157526991 CATGAAATGATGGCAGATTATGG + Intronic
915937859 1:160099209-160099231 CAGGAAAGGCTGGCAGGTGCGGG - Intergenic
916885967 1:169068716-169068738 TAGCAAATGATGGAATCTGCAGG - Intergenic
918667700 1:187172287-187172309 CAGGAAGTGACAGCTGCTGCAGG - Intergenic
918885794 1:190192485-190192507 CAGGACATGTTGGCACATGCTGG - Intronic
918917562 1:190664386-190664408 AAGGATATGAAGGCAGATGCAGG + Intergenic
920530804 1:206700912-206700934 CAGGATGGGATGACAGCTGCTGG + Intronic
920606898 1:207397782-207397804 CAACAAAAGCTGGCAGCTGCTGG - Intergenic
920936273 1:210437989-210438011 CAAGATATGATGGAATCTGCTGG - Intronic
922868964 1:228884567-228884589 CAGGAAATGTTTGCTGTTGCTGG + Intergenic
922898445 1:229118360-229118382 CCGGGCATGGTGGCAGCTGCTGG - Intergenic
1062824372 10:557467-557489 CAGGCCATGATGGCCTCTGCTGG + Intronic
1064208043 10:13341462-13341484 CAAGTAATGATTGCTGCTGCTGG - Intronic
1068206305 10:53859173-53859195 GAGGAGATGATGGGAGCTTCAGG - Intronic
1068653712 10:59553291-59553313 AAGGAAACCATGGCAGCAGCAGG + Intergenic
1070745292 10:78930068-78930090 CAGGAAAGGATGGCAGTGGCTGG + Intergenic
1072817659 10:98525548-98525570 GAGAAAACCATGGCAGCTGCTGG + Intronic
1072860028 10:98994172-98994194 CTGGAAATGATACCAGCTGTGGG + Intronic
1072911685 10:99507561-99507583 GAGGAAATGAAGTCATCTGCAGG + Intergenic
1074290187 10:112132530-112132552 CAGGGACTGTGGGCAGCTGCTGG - Intergenic
1075415216 10:122257912-122257934 GAGAAAATGATTGCAGCTGCTGG + Intergenic
1075538884 10:123295674-123295696 CAGGAAAGGAGGGCTGCTACTGG - Intergenic
1076434554 10:130431142-130431164 CAGGCAGCGATGTCAGCTGCAGG - Intergenic
1077109643 11:856470-856492 CTAGGAATGATGGCAGCTGGGGG - Intronic
1077941997 11:6852514-6852536 AAAAAAATGATGGTAGCTGCTGG + Intergenic
1079340567 11:19608297-19608319 GAGGACATGATGGCAGATGAAGG - Intronic
1079623192 11:22580932-22580954 CAGAAATTGATGGCAAATGCAGG + Intergenic
1081275222 11:41140243-41140265 CATGAAATGATGGGAGTTGGGGG - Intronic
1082635193 11:55585676-55585698 TAGGAAAAGGTGGCAGCTGGAGG - Intergenic
1082723337 11:56705790-56705812 CAGTACATTATGGCATCTGCAGG + Intergenic
1082764669 11:57157555-57157577 CAGGAAGTGAGGGCATCTGCTGG - Intergenic
1083956087 11:65983605-65983627 CCAGAAAGGATGGCAGCTGCTGG + Intergenic
1084026330 11:66452366-66452388 CTGGAAATGTTGGCAGGGGCTGG + Intronic
1084272391 11:68036275-68036297 CAAGAGCTGATGGCAGCCGCCGG + Exonic
1085130094 11:74030840-74030862 CAGTAAATGATATCACCTGCCGG + Intronic
1086322132 11:85662403-85662425 CAGGAAATGTGGCCAGCAGCTGG + Exonic
1086412633 11:86557864-86557886 TAGGAAATTATGGAATCTGCCGG - Intronic
1089960945 11:122616895-122616917 CAGGAAATGCTGGCAGGAGGAGG - Intergenic
1090185847 11:124738727-124738749 GAGGAAAGGATGGCTCCTGCTGG - Intergenic
1090203330 11:124871040-124871062 CAGGACCAGATGGCAGCTCCTGG + Exonic
1090597424 11:128334808-128334830 CAGGAAATGTGGGGAGCTGAGGG - Intergenic
1090868275 11:130721197-130721219 CAGAAAATGATGGCTGCTGTAGG - Intergenic
1091324629 11:134677048-134677070 AGGGAAAAGATGGCAGCTGATGG + Intergenic
1091937379 12:4444681-4444703 CAAGAAAGGATGGGGGCTGCAGG - Intronic
1092069849 12:5623644-5623666 CAGGAGAGGACGCCAGCTGCAGG + Intronic
1092398219 12:8146904-8146926 CAGGAAATCATAGCAGCCGTGGG + Intronic
1093871771 12:24301075-24301097 CAGAAGGTTATGGCAGCTGCTGG - Intergenic
1094454166 12:30613930-30613952 CAGGATAGGATGGAAGCTGGCGG - Intergenic
1096539827 12:52300731-52300753 CAGGGGATGATGGCAGGGGCTGG + Intronic
1096755182 12:53793502-53793524 GAGGAAAGGATGGGAGCTGGAGG + Intergenic
1100064230 12:90621849-90621871 CAGGTTATGATGGATGCTGCTGG + Intergenic
1100117910 12:91331143-91331165 TCTGAAATGATGGCAGCTGCAGG + Intergenic
1100858981 12:98784580-98784602 AAGAAAATGGTGGCAGCAGCTGG + Intronic
1103415230 12:120738668-120738690 CAGGTAATGGTGGCAGCTTTAGG + Exonic
1103507188 12:121449429-121449451 CTGGAACTGATGGCAGATGCAGG - Intronic
1103704255 12:122862759-122862781 CAGGAGGGCATGGCAGCTGCTGG - Exonic
1103956403 12:124579378-124579400 CCTGAAATGACGGCAACTGCAGG - Intergenic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1105315802 13:19261462-19261484 CAGTTAATGATGGTATCTGCTGG - Intergenic
1107104224 13:36626232-36626254 TAGGAAACGAGGGCTGCTGCTGG - Intergenic
1107675094 13:42787599-42787621 CAGGAAATGCTTTCAGTTGCTGG + Intronic
1108093213 13:46873032-46873054 CAGGAAACAATGGCAGTGGCCGG - Intronic
1108213086 13:48157942-48157964 CAGGGCATGGTGGCAGATGCCGG + Intergenic
1109437741 13:62328193-62328215 CAGGAAATTCTGGAAGCTACTGG - Intergenic
1109869877 13:68320952-68320974 CAGGAAAAGAAGCCAGCTCCTGG - Intergenic
1112821849 13:103346717-103346739 CAGGAAAAGATGGCCCCAGCAGG + Intergenic
1113058448 13:106295649-106295671 AAGGAGATGATGGCTGCTCCCGG + Intergenic
1115137706 14:30130955-30130977 CAGGAATTGATGGCAGCAGATGG - Intronic
1116606827 14:47009758-47009780 CAGGGAAAGAGGGCAGCAGCAGG + Intronic
1116719085 14:48469719-48469741 CAGGATATGATGCCAACTTCAGG + Intergenic
1117112631 14:52474936-52474958 AAGGAAGTGATTGCACCTGCAGG + Intronic
1117516435 14:56506749-56506771 CAGGAAATGTAGGCAGAGGCGGG + Intronic
1117618578 14:57560274-57560296 CAGGAAACGATGGCTTCTGTAGG - Intergenic
1117780131 14:59223532-59223554 CAGGCAATGTTGGAATCTGCTGG + Intronic
1118474150 14:66101515-66101537 CAGGAACAGATGGCAGGTCCAGG - Intergenic
1119047481 14:71332253-71332275 CAGGGACTGGTGGCTGCTGCTGG + Intronic
1119640568 14:76311378-76311400 CAGGTAATGATGGGAGCTCCTGG + Intronic
1119850612 14:77863932-77863954 AAGGAAATGAGGCCAGCTGCTGG + Intronic
1121720057 14:96103011-96103033 AAGGAGATGATGTCAGCAGCAGG + Intergenic
1121938639 14:98045205-98045227 CAGCAACTGATGGCTGCTGCAGG - Intergenic
1122588293 14:102826433-102826455 CAGGACAGCATGGGAGCTGCTGG + Intronic
1123194604 14:106604522-106604544 CAGAAGGTGATGGCAGCTTCTGG + Intergenic
1123208467 14:106736455-106736477 CAGGAAATGATGCCAGGTAGAGG - Intergenic
1124227015 15:27903322-27903344 CAGGAGAGGAGGGCAGCTGTGGG - Intronic
1124439871 15:29678045-29678067 CAGGGAGTGAGGGGAGCTGCAGG - Intergenic
1127526101 15:59792796-59792818 CGGATAATGATGGCAGCGGCAGG - Intergenic
1127760595 15:62135842-62135864 CGGGGAATGTTGGCTGCTGCTGG - Intergenic
1128413196 15:67419427-67419449 CAGGCAATGGTGGAAGCTGGAGG - Intronic
1128925197 15:71648955-71648977 CAGAAAATGATGTCACCTGCGGG + Intronic
1129064348 15:72888733-72888755 CAGGTAATGATGGAGACTGCAGG + Intergenic
1129120947 15:73396230-73396252 CAGGACAAGATGGCAGGTGTGGG - Intergenic
1129191876 15:73942117-73942139 CAGGAAGTGGTGGCAGGTGATGG + Intronic
1129294234 15:74591219-74591241 CAGCAATTGATGGCAACCGCAGG + Exonic
1129653994 15:77510680-77510702 CCGGAGCTGCTGGCAGCTGCTGG - Intergenic
1130032886 15:80332188-80332210 CAGAAGAAGCTGGCAGCTGCGGG + Intergenic
1130747752 15:86674355-86674377 CAGGAGCTGATGGCTGCAGCTGG - Exonic
1130777307 15:86998343-86998365 AAGAAATTGAGGGCAGCTGCTGG + Intronic
1131872589 15:96777316-96777338 CAGCTAATGAGGGCAGCAGCAGG + Intergenic
1134176335 16:12009631-12009653 GAGGAAGTGGTGGCAGCCGCTGG + Intronic
1136539724 16:30922730-30922752 CCGGCAAAGATGGCGGCTGCAGG - Intergenic
1138512166 16:57515135-57515157 CAGGAAGTCAGGCCAGCTGCAGG - Intronic
1139518254 16:67464593-67464615 GAAGAACTGATGACAGCTGCAGG + Intronic
1139935141 16:70565062-70565084 TAGGAAATGGTGGAAGCAGCAGG + Exonic
1140112704 16:72017399-72017421 CAGGCAATGAGGGCAGGAGCAGG + Intronic
1140958485 16:79889792-79889814 CAGCAAATGATGGCTGGGGCTGG + Intergenic
1141026061 16:80549630-80549652 CATGAAATCATGGTAGCTCCAGG + Exonic
1141476192 16:84275068-84275090 TAGGAAATCAAGGCATCTGCAGG - Intergenic
1141710960 16:85698801-85698823 CAGGAAAGCATGGGAGCTGGGGG - Intronic
1141850217 16:86640068-86640090 AAAGAAATGCTGGAAGCTGCTGG + Intergenic
1142004327 16:87682142-87682164 CAGGAAATGAAGCAAGCTGCTGG - Intronic
1143385660 17:6528868-6528890 CAGGCAAAGAGGGGAGCTGCAGG + Intronic
1144668776 17:17119582-17119604 CAGGTACTGATGACAGCTTCAGG - Intronic
1145065207 17:19757355-19757377 CAGGAAGGGATGGGAGCTGTTGG - Intergenic
1145822760 17:27852370-27852392 CAGGATATGATGGAAGATGGTGG - Intronic
1145933549 17:28702177-28702199 CAGGAAGCGGTGGCAGCAGCAGG - Exonic
1145998118 17:29115988-29116010 CAGGAAATGCTGGCCACTGCTGG - Intronic
1146313297 17:31787771-31787793 CAGGAAGTGAAGGCAGAGGCTGG + Intergenic
1146653916 17:34623953-34623975 CAAGAAATGCTGGGAGCTGATGG - Intronic
1146841399 17:36157956-36157978 CATGACATGATGGTAGCTGTGGG + Intergenic
1147987224 17:44313581-44313603 CAGGAACTGAAGGATGCTGCAGG - Intronic
1148029714 17:44611072-44611094 CAGGAAAGGAGGGAAGCAGCCGG + Intergenic
1148467021 17:47871256-47871278 CAATAAATGATGACAGATGCAGG - Intergenic
1148688200 17:49512539-49512561 CAGGAAGTGAAGGCACCTGGGGG - Intronic
1148817653 17:50341943-50341965 AAGGAAAAGGTGGGAGCTGCAGG + Intergenic
1150720115 17:67607283-67607305 CAGGAAAGGATGCCAGCCCCAGG + Intronic
1152152678 17:78612342-78612364 CAGGCCACGATGGCAGCTGGTGG + Intergenic
1152340164 17:79720058-79720080 CAGGACAGGCTGGCAGCTGTAGG - Intergenic
1152579690 17:81160443-81160465 GAGGAAATGAGGGCAGCGGACGG - Intronic
1153003267 18:475331-475353 CAGGAAATGATGGAAATTCCTGG + Intronic
1153473570 18:5472378-5472400 CAGGAAATTACTGCTGCTGCTGG + Intronic
1153535682 18:6099055-6099077 CAGGTCCTGATGGCAGCAGCAGG + Intronic
1158487714 18:57882514-57882536 CAGGTATTGATGACAGCTGGAGG + Intergenic
1158652944 18:59303869-59303891 AAGGAAGAGATGGCGGCTGCTGG + Intronic
1161062901 19:2223914-2223936 CAGGACATGATGGAAGGTTCTGG - Intronic
1161440992 19:4291545-4291567 CTGGGAGTGATGCCAGCTGCGGG + Intergenic
1161537020 19:4825814-4825836 CAGGGCATGGTGGCAGGTGCTGG + Intronic
1161684680 19:5696886-5696908 GCGGAAATGCTGGCAGCCGCCGG + Intronic
1162035366 19:7935562-7935584 CAGCACATGCTGGCAGGTGCGGG - Intronic
1162794817 19:13081595-13081617 CAGGAGAGGAGGGGAGCTGCCGG - Intronic
1168298831 19:55391551-55391573 CAGGACATGCTGGCATCTACTGG + Exonic
925007451 2:455055-455077 CAGAAGCTGCTGGCAGCTGCTGG + Intergenic
929016159 2:37497918-37497940 CTGGAAATGATGGCATCCACCGG - Intergenic
929032334 2:37660828-37660850 CTGGAAATGATGGGATCTGGAGG + Intronic
929404869 2:41630141-41630163 CAGGAAACGATGTCATCTGATGG + Intergenic
929863338 2:45697638-45697660 CAGGTGAAGATGGCACCTGCAGG - Intronic
929964008 2:46520167-46520189 TGGGACATGAAGGCAGCTGCAGG + Intronic
934493628 2:94779393-94779415 CAGCCCATGAGGGCAGCTGCGGG - Intergenic
935191875 2:100784304-100784326 CAGGAAAGGATGGAAGGTTCTGG + Intergenic
935378408 2:102423604-102423626 CAGGAAACCAGGGCTGCTGCTGG + Intronic
935643122 2:105309289-105309311 CAGAGAATGACGGGAGCTGCAGG + Intronic
936038190 2:109129146-109129168 CAGGAAGTGCGGGCAGCGGCCGG - Intergenic
937637403 2:124171432-124171454 CTTGATATGATGGCAGCTCCTGG + Intronic
939827267 2:147029842-147029864 GATGCAATGATGGCAGCTGGAGG - Intergenic
941440406 2:165528751-165528773 CAGGTAGTGATGGCAGCAGCAGG + Intronic
941765545 2:169292569-169292591 CAGGAAATGAACTCAGGTGCCGG + Intronic
941930166 2:170930464-170930486 CAGGAAATGAAGGTAGCACCAGG - Intronic
942890440 2:180980879-180980901 AAGGAAATGGAGGCAGCTGTGGG - Exonic
946475140 2:219999952-219999974 CAGGAATTTGTGGCAGCTGTGGG - Intergenic
947712525 2:232324181-232324203 GAGGCCATGAAGGCAGCTGCTGG - Intronic
947719919 2:232363996-232364018 GAGGCCATGAAGGCAGCTGCTGG - Intergenic
947731490 2:232433861-232433883 GAGGCCATGAAGGCAGCTGCTGG - Intergenic
948226925 2:236318379-236318401 GAGGAAATAATGGCAGCTGTGGG + Intergenic
1169075926 20:2759796-2759818 AAGGAAGTGGGGGCAGCTGCGGG - Exonic
1170096529 20:12651338-12651360 CAGATAATAATAGCAGCTGCAGG - Intergenic
1171085229 20:22232575-22232597 CAGGCAATGAGTGCAGCTGCTGG + Intergenic
1171422322 20:25025438-25025460 CAGAAAATGAACGCAGATGCTGG - Intronic
1171884777 20:30644009-30644031 CAGCCCATGAGGGCAGCTGCGGG - Intergenic
1172119250 20:32588162-32588184 GAGGAGAGGAGGGCAGCTGCAGG + Intronic
1172884334 20:38221279-38221301 CTGGAGATGCTGGTAGCTGCGGG + Intronic
1172965931 20:38835313-38835335 CAGGACATGATGGGGGCTGCAGG - Intronic
1173919252 20:46731553-46731575 CAGGATGTGACTGCAGCTGCGGG + Intronic
1175053684 20:56178422-56178444 CAGGGAGTGAAGGAAGCTGCAGG + Intergenic
1175181281 20:57149298-57149320 CAGAAAATGATGGAAGGCGCAGG + Intergenic
1177367165 21:20153345-20153367 CAGGCTATGAAAGCAGCTGCAGG - Intergenic
1178438003 21:32576220-32576242 CAGGAGCAGATGGCAGCAGCCGG - Intergenic
1178490589 21:33048628-33048650 CAGGAAATGATGAGAGGAGCAGG - Intergenic
1179137163 21:38689762-38689784 AAGGAAAGGATGGCAACTGATGG + Intergenic
1179956157 21:44740284-44740306 CACAAAATGATGACAGATGCAGG + Intergenic
1179958268 21:44753151-44753173 AAGGAAATGATTGCATCTCCAGG + Intergenic
1180109139 21:45639855-45639877 CCGGAAATCAGGGCAGCTGTGGG + Intergenic
1180926607 22:19559514-19559536 CAAGACAGGAGGGCAGCTGCGGG - Intergenic
1181286771 22:21758211-21758233 CAGGAAATGCCTGGAGCTGCTGG - Exonic
1182414167 22:30210367-30210389 CAGAACATGAGGGCAGCAGCAGG + Intergenic
1183382362 22:37496541-37496563 CAGCAAAGGGTGGAAGCTGCTGG - Exonic
1184199741 22:42959901-42959923 CAGGAAATGATGAAATGTGCTGG - Intronic
1184814165 22:46858038-46858060 CAGGAAAGTCTGGCAGCTCCTGG - Intronic
949500082 3:4671518-4671540 CAGGGAATCGTGGCAGCTGGAGG - Intronic
949568735 3:5270755-5270777 CAGGAAATGAGGGCAGCCGCTGG - Intergenic
950533313 3:13565737-13565759 CAGGAAAGGTTGGCAGGTGGAGG - Intronic
952377030 3:32776421-32776443 GGGGATATGAAGGCAGCTGCTGG + Intergenic
952827914 3:37539342-37539364 CAGGAAAGGAAGGCAGTTGCAGG + Intronic
955036974 3:55277681-55277703 CAGAAGATAATGACAGCTGCAGG + Intergenic
956035012 3:65081118-65081140 CACAAAATGATGGCATTTGCAGG + Intergenic
957379890 3:79413489-79413511 CTGTGAATGGTGGCAGCTGCCGG + Intronic
959089839 3:101890042-101890064 GAGGAACTGATGATAGCTGCTGG + Intergenic
959319750 3:104856825-104856847 CAGGAGATGATGGCAGCCAAAGG - Intergenic
962921876 3:139957718-139957740 GGGGAAATGATGTCAGCTGATGG + Intronic
967133766 3:186496193-186496215 CAGGAAAAGCGGGCAGCTGCAGG - Intergenic
967765562 3:193275500-193275522 AAGGAAATGCTGGAAGCTTCTGG - Intronic
968027116 3:195451697-195451719 CAGGAAAGGTTGGCAGGTGCTGG - Intergenic
969130061 4:4984426-4984448 CAGGAAATGGAGACAGCTGAAGG + Intergenic
970036225 4:11738634-11738656 CAGACCATGAAGGCAGCTGCAGG + Intergenic
970503150 4:16699137-16699159 CAGGAGATGATGGCATCTTCAGG + Intronic
971501866 4:27326954-27326976 AAGGAAATGCTAGCTGCTGCAGG - Intergenic
971856698 4:32053695-32053717 CAGCCAATGAAAGCAGCTGCAGG - Intergenic
972081197 4:35152397-35152419 AAGGAACTGAGGGCAGCCGCTGG + Intergenic
972349831 4:38226297-38226319 CAGGCAAAGATGGCAGGGGCTGG - Intergenic
973052467 4:45612064-45612086 TAGGAAAAGGTGGCAGCTGGAGG - Intergenic
973791021 4:54378213-54378235 CCAGACATGATGGCAGGTGCCGG + Intergenic
974132907 4:57778060-57778082 AAGGGTATGATGGCAGATGCTGG - Intergenic
975640614 4:76496338-76496360 CAGGAAGTGATGGCATCTCTGGG - Intronic
980342147 4:131564605-131564627 TAGGAAATGAGGGCAGCCTCAGG - Intergenic
981855538 4:149286316-149286338 CAAGAAATGATCACAGTTGCAGG + Intergenic
982584872 4:157222927-157222949 CAGGAAATGATGGCAGCTGCTGG - Intronic
982616548 4:157644431-157644453 CAGGAGATGAAGGAAGCGGCTGG - Intergenic
985075083 4:186206095-186206117 CAAGAAATGCTGGCAGCCACCGG - Intronic
985236469 4:187880729-187880751 CAAGAACCAATGGCAGCTGCTGG - Intergenic
986469653 5:8061072-8061094 CAGGGAAGCGTGGCAGCTGCCGG - Intergenic
986540441 5:8839618-8839640 CAGGGAAGCGTGGCAGCTGCCGG + Intergenic
987209476 5:15665155-15665177 CAAGAAATGATAGCTACTGCTGG - Intronic
988634848 5:32971447-32971469 CAGAAAATGATGGCTACTGTGGG + Intergenic
991328644 5:65466366-65466388 AAGGAAATGCTGGCATCTGAGGG - Intronic
993385054 5:87252629-87252651 ATGGAAGTGATGGCAGCCGCTGG - Intergenic
993886654 5:93422938-93422960 CAGGAAATTTTGCCAGCCGCTGG - Intergenic
995126612 5:108583258-108583280 CAGAGACTGAGGGCAGCTGCAGG - Intergenic
997081901 5:130748966-130748988 ATAGAAATGATGGCAGCTACAGG + Intergenic
998474138 5:142406738-142406760 CAGTAAATGCTGGCTGCTGTGGG + Intergenic
999035538 5:148344644-148344666 CAGTAAAGAATGGCAGCTGGAGG + Intergenic
999619910 5:153462392-153462414 GAGGAAATGATTTCAGCTGGAGG - Intergenic
999934869 5:156475690-156475712 CAGGAATTGTTTGCAGCTGTTGG - Intronic
1000547174 5:162617869-162617891 CAAGAAATGTGGGCAGCTTCTGG - Intergenic
1000638295 5:163669337-163669359 CAGGAAATGGTGCCAGAAGCAGG + Intergenic
1001175753 5:169467536-169467558 AAGGAAGTGAAGGCAGCTCCAGG + Intergenic
1001667747 5:173447280-173447302 TAGGGCAAGATGGCAGCTGCTGG - Intergenic
1003127671 6:3368448-3368470 CAGAATTTGATGGCAGCTACGGG - Intronic
1004285084 6:14314285-14314307 TAGGAAATGATGACAGCAACTGG + Intergenic
1004523940 6:16388214-16388236 CATGCAATGCTGTCAGCTGCAGG + Intronic
1004815145 6:19304486-19304508 CAGCAAATGATGGCAGGAACAGG - Intergenic
1005143174 6:22657702-22657724 CATGAAATGATGACAGATACGGG - Intergenic
1006735134 6:36268022-36268044 CAGGCCAGGGTGGCAGCTGCAGG - Intronic
1006784579 6:36657298-36657320 CAGCAAATTATGGAAGCTGAGGG + Intergenic
1007738130 6:43994509-43994531 CAGGAAGGGAGGGAAGCTGCAGG + Intergenic
1007839374 6:44703083-44703105 CAGGCAATGGAGCCAGCTGCTGG + Intergenic
1010445251 6:75942227-75942249 CAAGAAAAAAAGGCAGCTGCTGG - Intronic
1011441067 6:87387894-87387916 CAAGAAAGGAAGGCAGCTGGAGG + Intronic
1011525848 6:88263959-88263981 CAGGAGATGATGGAAGCTAAAGG + Intergenic
1012229812 6:96747616-96747638 CAGGACATGATGGCTCCTGCAGG - Intergenic
1013346896 6:109269226-109269248 AAGGACATGGTGGCAGCTTCTGG + Intergenic
1014038152 6:116791937-116791959 TAGGAAATGAAGGGAGCTTCAGG + Intergenic
1015284451 6:131469352-131469374 CAGGAAATGATCTCAGCTCCTGG - Intergenic
1015343637 6:132130696-132130718 CAGGAAAAGAAGGCAGATGCTGG - Intergenic
1017812821 6:157996471-157996493 CAGGAAATGGTGGGAGATGAGGG - Intronic
1018065117 6:160119115-160119137 GGGGAAATGATGGCAGCAGCAGG - Intergenic
1018642466 6:165917239-165917261 CAGGAAGAGATGTCCGCTGCGGG - Intronic
1018703810 6:166449154-166449176 AAGGAAGTGCTGGCAGCTGCTGG + Intronic
1018893242 6:167996922-167996944 CAGGAGGCGATGGCAGCTGGAGG + Intronic
1018944489 6:168337008-168337030 CAGGAAAGGATGGCGGCTACTGG - Intergenic
1021534826 7:21691364-21691386 CAGGAGGGCATGGCAGCTGCTGG + Intronic
1026553678 7:71388426-71388448 CAGGACATGATGACAGCAGGGGG + Intronic
1026634733 7:72071364-72071386 CTGGAAATCATTTCAGCTGCAGG - Intronic
1026791454 7:73335167-73335189 AAGGAAGGGAGGGCAGCTGCTGG + Intronic
1026977007 7:74505179-74505201 CAGAAAATGAAGGCAGAGGCCGG - Intronic
1028771232 7:94624222-94624244 CTGGCAATGATTGCAGCTGGAGG + Intronic
1029415802 7:100442413-100442435 CATGGGATGATGCCAGCTGCTGG + Intergenic
1029673639 7:102050966-102050988 CAGGACAGGATGGCAACTGGTGG - Intronic
1029892017 7:103940546-103940568 ATGGAAAGGATAGCAGCTGCTGG - Intronic
1031077848 7:117229885-117229907 GAGGAGATGGTGGCAGCGGCGGG - Intronic
1031526648 7:122829653-122829675 CATGAAATGATGGAAGCTGATGG - Intronic
1031869914 7:127080250-127080272 CAAGGAATGCTGGCAGCTTCTGG + Intronic
1031979754 7:128116882-128116904 CAGGACAGGAGGGCAGCAGCAGG + Intergenic
1032704392 7:134409499-134409521 CTGGGAATGATGGCAGCTGGTGG - Intergenic
1033021408 7:137728648-137728670 GAGGAAATGATGGCAGATGGAGG - Intronic
1033132376 7:138755646-138755668 CATGGTCTGATGGCAGCTGCAGG - Intronic
1033242055 7:139688511-139688533 CAGGAGCTGATGGCTGCTGCCGG + Intronic
1033249573 7:139747192-139747214 CCTGAATTGATGGCTGCTGCAGG - Intronic
1033449811 7:141452492-141452514 AAGGAAATATTGGCAGATGCTGG - Intronic
1034137317 7:148782937-148782959 CAGGAAATGGTGGCAGGCACAGG - Intronic
1034763991 7:153700388-153700410 CCTGAAATGATTCCAGCTGCGGG - Intergenic
1035298303 7:157879437-157879459 AAAGAAAAGATGGGAGCTGCAGG - Intronic
1035542059 8:447921-447943 GAAGAAAGGATGGCAGCAGCCGG + Intronic
1036775269 8:11607503-11607525 CAGGACCTCATGGCAGGTGCTGG + Intergenic
1037864278 8:22430641-22430663 CAGGAAGTGACGGCAGCTTTGGG + Intronic
1039340001 8:36637354-36637376 CAAGAAATGTTGGCAGCCACTGG + Intergenic
1039536865 8:38324345-38324367 AAGAAAATAATGGGAGCTGCAGG - Intronic
1039608875 8:38903436-38903458 CATGACATGATGGGATCTGCAGG - Intronic
1039773494 8:40712742-40712764 CAGGAAAAGATGGCACCTGGAGG + Intronic
1041332250 8:56739706-56739728 CCGGAAATGATGGGAGCAGGAGG - Intergenic
1041643607 8:60229244-60229266 CAGGAAATGGTGGGAGATGTTGG - Intronic
1042796710 8:72671608-72671630 CAGGAAAGGATGGAAGATGGAGG - Intronic
1043785485 8:84393335-84393357 AAGGAACTGAGGGCAGCTTCTGG - Intronic
1044707685 8:95024708-95024730 CAAGAAGTGATGGGTGCTGCTGG - Intronic
1045921799 8:107538782-107538804 CAGGAAATGATGCCAGCTCTTGG + Intergenic
1046056207 8:109082089-109082111 CAGTCCATGAAGGCAGCTGCGGG - Intergenic
1046536019 8:115511468-115511490 TAGGAAATGATTGAAGCTGTGGG - Intronic
1048392965 8:133985644-133985666 CAAAAAATGATGGCAGGGGCCGG + Intergenic
1049010102 8:139881780-139881802 CAGAAAAAGATGGCAGCTCTTGG + Intronic
1050505313 9:6342272-6342294 AAGGAGTTGATGGGAGCTGCTGG - Intergenic
1050590382 9:7154272-7154294 CTGGAAACGATAGCAGCTGTTGG + Intergenic
1051154822 9:14130176-14130198 AAGGATACGATGCCAGCTGCTGG - Intronic
1051712544 9:19946656-19946678 GAGGAAGTGCTGGCATCTGCTGG - Intergenic
1051891260 9:21945054-21945076 CAGGGCTTGATGGCAGCTTCTGG + Intronic
1052988994 9:34507732-34507754 CAGGAAGGGGTGGCTGCTGCTGG + Intronic
1053663456 9:40300638-40300660 CAGCCCATGAGGGCAGCTGCGGG + Intronic
1053663959 9:40304535-40304557 CAGCCCATGAGGGCAGCTGCGGG + Intronic
1053664926 9:40310741-40310763 CAGCCCATGAGGGCAGCTGCGGG + Intronic
1053914501 9:42935791-42935813 CAGCCCATGAGGGCAGCTGCGGG + Intergenic
1054376085 9:64450769-64450791 CAGCCCATGAGGGCAGCTGCGGG + Intergenic
1054519688 9:66065543-66065565 CAGCCCATGAGGGCAGCTGCGGG - Intergenic
1054520655 9:66071750-66071772 CAGCCCATGAGGGCAGCTGCGGG - Intergenic
1054521158 9:66075647-66075669 CAGCCCATGAGGGCAGCTGCGGG - Intergenic
1056396543 9:86186658-86186680 AAGGAACTGATGACTGCTGCAGG + Intergenic
1056557316 9:87700397-87700419 AAGGAGATGATGGGAGCTGAAGG + Intronic
1057304452 9:93904188-93904210 CAGGCATTGATGTCTGCTGCAGG - Intergenic
1057546303 9:96022014-96022036 GAGGAAGGGAAGGCAGCTGCAGG - Intergenic
1061217635 9:129231098-129231120 CAGGAAATTATGGAAGCCGATGG - Intergenic
1061592690 9:131608240-131608262 CAGGAGAGGACGGCTGCTGCTGG - Intronic
1061667227 9:132167643-132167665 CATGCAATGATGGCAGCCCCTGG + Intronic
1062485574 9:136773551-136773573 CAGCTAATGATGGCTGTTGCTGG - Intergenic
1190870279 X:54419164-54419186 CAGGAAATAAAGGGAGCTGCAGG - Intergenic
1192140006 X:68639058-68639080 CAGGAAGTGGTGGCAACTGGAGG - Intergenic
1192640349 X:72856621-72856643 AAGGAGAAGATGGCCGCTGCTGG - Intergenic
1192641362 X:72864155-72864177 AAGGAGAAGATGGCCGCTGCTGG + Intergenic
1192736171 X:73851367-73851389 CAGGAAAAGATGGCGGCTGAAGG - Intergenic
1195386819 X:104321448-104321470 AAGGAAATGAGGGCAGCTATTGG + Intergenic
1197696713 X:129557704-129557726 AAGGAAATGAGGGCAGCTCTGGG - Intronic
1198107003 X:133471353-133471375 CGGGAAATTATGGGAACTGCTGG - Intergenic
1199338085 X:146642933-146642955 CAGCACATGAAAGCAGCTGCAGG + Intergenic