ID: 982589164

View in Genome Browser
Species Human (GRCh38)
Location 4:157282508-157282530
Sequence GACATGGATTTCCGAAGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982589164 Original CRISPR GACATGGATTTCCGAAGACC TGG Intronic
902097791 1:13960797-13960819 GCCAGGGTTTTCCGAAGGCCTGG - Intergenic
903092368 1:20933066-20933088 GATATGGATACCAGAAGACCTGG + Intronic
907272566 1:53299443-53299465 GAGATGGATTTCCCAATAACAGG - Intronic
909239152 1:73190708-73190730 GACATGAATTTTTGAAGGCCTGG - Intergenic
917716745 1:177745891-177745913 GACCTGGATTCCCGAACACTTGG - Intergenic
920316540 1:205079659-205079681 GGGATAGATTTCAGAAGACCTGG - Intergenic
921210238 1:212889784-212889806 GACCTGGAGTTGGGAAGACCTGG + Intronic
1065483699 10:26217148-26217170 GACATGGAATTCCGTGGTCCTGG + Intronic
1065871628 10:29960831-29960853 GATATGGCTTTCCACAGACCTGG - Intergenic
1067050167 10:43011332-43011354 GACATGAATTTTGGAAGGCCAGG + Intergenic
1067440731 10:46308032-46308054 GACATGGAGCTCTGAAGAGCAGG - Intronic
1080698590 11:34624664-34624686 GACATTGATGTCCGGAAACCAGG + Intronic
1082256176 11:50035740-50035762 GACTTTAATTTCCAAAGACCTGG - Intergenic
1084029250 11:66471421-66471443 GACCTGGAAGGCCGAAGACCTGG - Intronic
1087823037 11:102732704-102732726 GGAATGGAAATCCGAAGACCTGG + Intergenic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1096607877 12:52779634-52779656 ATCATGGAATTCCAAAGACCTGG + Intergenic
1099119622 12:78672153-78672175 GGCCTGGATTTCCCCAGACCTGG + Intergenic
1103034426 12:117644926-117644948 GGAGTGGATTTCCAAAGACCAGG - Intronic
1104668656 12:130665885-130665907 AGCATGCATTTCCGAAGAGCAGG - Intronic
1114431290 14:22663546-22663568 GACATAGATTTCTGAAGTCAAGG + Intergenic
1122907205 14:104807296-104807318 GCCATGGAATTCCGAATTCCTGG - Intergenic
1128516712 15:68346710-68346732 GACACGGATTTCAGCAGTCCTGG - Intronic
1130836090 15:87651506-87651528 GACTTGGCTTTCTTAAGACCTGG - Intergenic
1130930413 15:88422746-88422768 AACATGGACTTCCCATGACCAGG + Intergenic
1131659335 15:94497489-94497511 GACCTGGATTTCCGAACTACTGG - Intergenic
1133715155 16:8440638-8440660 GAGATGGATTTCCAAAGTCGTGG + Intergenic
1134219780 16:12344818-12344840 GCTATTGATTTCCCAAGACCTGG - Intronic
1134897548 16:17902563-17902585 GACTTGAATTACTGAAGACCTGG - Intergenic
1139465462 16:67151576-67151598 GGCCTGAATTTCAGAAGACCTGG - Intergenic
1145107218 17:20128588-20128610 GTCAGGGATTTCAGATGACCTGG + Intronic
1146445103 17:32927347-32927369 CACAGGGATTTCCGGAGTCCAGG - Intergenic
1166942472 19:46375137-46375159 GACATGGACTCCCCAAGCCCAGG - Intronic
1168065732 19:53919306-53919328 GACAGGGATTGCCCCAGACCTGG + Intronic
925007576 2:456189-456211 GGCATGGATTTCCCAAGAGTTGG + Intergenic
935076742 2:99753034-99753056 TACATTGATTTCTGATGACCAGG + Intronic
936095030 2:109524895-109524917 CACATGGAATTCCCAAGCCCTGG + Intergenic
946591012 2:221246879-221246901 GACATGGATTGCTTAAGATCAGG + Intergenic
948152785 2:235757502-235757524 GACATGGATCTGCCTAGACCAGG - Intronic
949011998 2:241686277-241686299 GACATGGATTACAAAAGAGCTGG + Intronic
1182304956 22:29361415-29361437 GATTTGGATTTCAGAAGAACTGG + Intronic
1182312269 22:29417550-29417572 GATTTGGATTTCAGAAGAACTGG + Intronic
1182687998 22:32135694-32135716 GATTTGGATTTCAGAAGAACTGG - Intergenic
1182692116 22:32171448-32171470 GACATGGAAGACCGGAGACCTGG + Intergenic
949214719 3:1552073-1552095 AACATGAATTTCGGAAGCCCAGG + Intergenic
954624616 3:52015803-52015825 GAGATGGATGCCCGAAGCCCTGG - Intergenic
957511496 3:81194257-81194279 AACATGAATTTCAGAAAACCAGG - Intergenic
969830610 4:9793404-9793426 GAAATGGATTCCCAAGGACCAGG - Intronic
970902064 4:21171623-21171645 AACATGGATTTGGGAACACCTGG + Intronic
974116671 4:57587526-57587548 GCCATGTATTTTCCAAGACCAGG + Intergenic
978274141 4:106928634-106928656 GACATGGATTTCAGAGGGCAAGG - Intronic
980174328 4:129326262-129326284 GACATGTATATCTGAAGATCAGG + Intergenic
980693338 4:136324412-136324434 GAAATGGATAACAGAAGACCAGG + Intergenic
982589164 4:157282508-157282530 GACATGGATTTCCGAAGACCTGG + Intronic
987016976 5:13830611-13830633 CAGATGGATTTCCGAGGACTTGG - Exonic
994181968 5:96777403-96777425 GACATGGATTTCTAAGGAACTGG - Intronic
995031741 5:107489360-107489382 GACAGGGTTTTACCAAGACCAGG + Intronic
996888827 5:128392844-128392866 CATATGTATTTGCGAAGACCTGG + Intronic
1000284503 5:159815532-159815554 GACATGAATTTTGGAAGGCCAGG + Intergenic
1001169224 5:169402730-169402752 GGCATGGATTTCCGAATTGCTGG - Intergenic
1002894502 6:1368814-1368836 AACATGGTTTTCAGGAGACCTGG - Intergenic
1010549678 6:77205966-77205988 GACATGGATTTTGGAAGGCCAGG - Intergenic
1017679047 6:156845363-156845385 GACATGGAATTCAGAAAACAGGG - Intronic
1017895313 6:158674459-158674481 TACATGGAGTCCAGAAGACCAGG - Intronic
1018865529 6:167744507-167744529 GACAGGGGCTTCTGAAGACCAGG + Intergenic
1022843029 7:34182723-34182745 GATATGGATTTTCGGGGACCAGG + Intergenic
1024162283 7:46688947-46688969 CACTTGGATTTCCTAATACCAGG - Exonic
1040807115 8:51407125-51407147 GATTTGGATTCACGAAGACCTGG - Intronic
1044657923 8:94567503-94567525 GACATGGACTTCCAAAGTGCTGG + Intergenic
1047235193 8:123035174-123035196 GACACTGATTTCCAAAGAACAGG - Intronic
1053387857 9:37709032-37709054 GACAATGATTTCCTGAGACCAGG + Intronic
1054739571 9:68791207-68791229 GAGATGGATTGCCGAATCCCAGG - Intronic
1054934187 9:70669178-70669200 GACCTGGGTGTCTGAAGACCTGG + Intronic
1060620246 9:125058544-125058566 CTCATGGATTTCTGAAGACATGG + Intronic
1061393147 9:130328678-130328700 GCCCTGGAGTTCCGCAGACCCGG + Intronic
1188161108 X:26804284-26804306 GGCATGAATTTCAGAAGATCTGG + Intergenic