ID: 982591173

View in Genome Browser
Species Human (GRCh38)
Location 4:157313536-157313558
Sequence TTTAAGGTCTTTCAGGGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982591166_982591173 26 Left 982591166 4:157313487-157313509 CCAGTGATAAGGATATTTTTATC 0: 1
1: 1
2: 0
3: 38
4: 424
Right 982591173 4:157313536-157313558 TTTAAGGTCTTTCAGGGTAGGGG 0: 1
1: 0
2: 0
3: 17
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982591173 Original CRISPR TTTAAGGTCTTTCAGGGTAG GGG Intronic
902636262 1:17736806-17736828 TTTAAGGAATTTCCAGGTAGTGG - Intergenic
907420087 1:54341385-54341407 TTTAAGGTTTCTCAAGGTATGGG - Intronic
908117935 1:60959155-60959177 TATAAGCTCTTTCAGGATCGTGG + Intronic
908698668 1:66873705-66873727 TTTCAGCTCTTTCAGTGTAAGGG + Intronic
912768588 1:112440018-112440040 TTTAAGCTCCTTGAGGGCAGTGG + Intronic
913229986 1:116733796-116733818 TTTATTGGCTTTCAGGGAAGAGG - Intergenic
913549998 1:119907853-119907875 TTTAAGGTCCTCAAGGGTCGAGG + Intergenic
916007177 1:160673415-160673437 TGTAACGGCTTTCAGGGTGGGGG + Intergenic
916462218 1:165037360-165037382 TTGTAGGTCCTTCAGGGAAGAGG - Intergenic
916884440 1:169053240-169053262 TTTAAAGTCCTTGAGGGCAGAGG + Intergenic
916913527 1:169380466-169380488 TTTAATCTTTTTCAGGGTAATGG + Exonic
918558244 1:185831032-185831054 TTTAAACTCTTTCAGGGAACAGG + Intronic
920187954 1:204173521-204173543 TTTTAGATCCTTCATGGTAGGGG + Intergenic
920423299 1:205850789-205850811 TTTATGGTTATTCAGAGTAGAGG + Intergenic
923889418 1:238195825-238195847 TTTAAGAACTTATAGGGTAGTGG + Intergenic
1064720956 10:18228018-18228040 TTTACATTCTTTCAGGGTAGGGG + Intronic
1065815090 10:29475898-29475920 TTTAAGTTCTTAAAAGGTAGGGG + Intronic
1069279198 10:66632621-66632643 TTTAGTGTTTTTCAGGGTAATGG + Intronic
1070384410 10:75911753-75911775 TTTAAGCTCTTTGAAGGCAGGGG - Intronic
1072185909 10:93038801-93038823 TTTGAGTTCTTCAAGGGTAGAGG - Intronic
1072263589 10:93705782-93705804 TTTAAGACCATTCCGGGTAGAGG - Intergenic
1073747586 10:106487143-106487165 TTTTAGATCTTACAGGGTTGTGG + Intergenic
1074094470 10:110297966-110297988 TTTAATGTCTTTGAGAATAGAGG + Intronic
1076184177 10:128433754-128433776 TTTGAGGTCTTGCAGGATAGAGG + Intergenic
1078789918 11:14532071-14532093 TTTAATTTTTTTCAGGGTACAGG + Intronic
1078911043 11:15732306-15732328 TTTGAGGTCTTTCAGGTCAATGG + Intergenic
1080397504 11:31903403-31903425 TTTAAAGTCTCTGAGGGTTGGGG - Intronic
1081418112 11:42840070-42840092 TTCAAGGTCTTTAGGGGTGGTGG - Intergenic
1081950857 11:47041200-47041222 TTTCAGGATTTTCAGGGTTGGGG + Intronic
1083471858 11:62889408-62889430 GGAAAGGTGTTTCAGGGTAGAGG + Intergenic
1085123956 11:73984824-73984846 CTTAAATTCTTTCAGGGTGGGGG + Intergenic
1085802151 11:79600621-79600643 TGTGAGCTCTTCCAGGGTAGGGG + Intergenic
1086943699 11:92823964-92823986 TTTAAGCTGTTTCATTGTAGTGG + Intronic
1087711655 11:101560585-101560607 TTTCGGGTATTTCAGGGCAGTGG - Intronic
1089241149 11:117081321-117081343 TTTAAAGTCTTTGAGGCTAGAGG + Intronic
1092532197 12:9353860-9353882 TTAAAGTTCTTTCAGCGAAGTGG - Intergenic
1093334864 12:17891794-17891816 TAAAGGGTCTTTTAGGGTAGAGG - Intergenic
1093525178 12:20096984-20097006 TTCAAGGACTTTCAGGGGAGAGG + Intergenic
1093796181 12:23315063-23315085 ATTAAGGGCTTTGAGAGTAGGGG - Intergenic
1093904385 12:24673382-24673404 TTTAAGATCTTTCATGAAAGGGG + Intergenic
1094690580 12:32764463-32764485 TTTAAGGAGGTTCAGGGGAGTGG + Intergenic
1094715459 12:33010243-33010265 TTTTATGGTTTTCAGGGTAGAGG + Intergenic
1095308971 12:40673079-40673101 TTTAATGAGTTTCAGGGTTGTGG - Intergenic
1096851011 12:54437364-54437386 TTTAAGATTTCTCAGGGTGGAGG + Intergenic
1096876451 12:54633730-54633752 TGTAAGCTCTGTCAGGGCAGGGG - Intronic
1097994215 12:65870143-65870165 TTTAAGACCTTTCAGTCTAGGGG + Intronic
1098907296 12:76175363-76175385 TTTATAGTCTTTGGGGGTAGTGG - Intergenic
1099000177 12:77170181-77170203 TGTAAGCTCTTTAAGGGCAGAGG - Intergenic
1099931780 12:89083455-89083477 TTTTAGAGCTTTCAGCGTAGTGG + Intergenic
1100007778 12:89914465-89914487 TATAAGCTATTTGAGGGTAGAGG + Intergenic
1102906207 12:116677060-116677082 TTTTAGGTCTGTGAGGGCAGGGG - Intergenic
1103222327 12:119256197-119256219 CATAAGGTCTTTGAGGGCAGGGG - Intergenic
1106916356 13:34519436-34519458 TTGAAGACCTTTCCGGGTAGAGG - Intergenic
1108967642 13:56330268-56330290 TTTAAGCTCTTTGAGAGTAAGGG - Intergenic
1109052118 13:57496182-57496204 TGAAAGCTCTTTGAGGGTAGGGG + Intergenic
1109188984 13:59303153-59303175 GTTAATGTTTTTCAGGGGAGAGG - Intergenic
1110398043 13:75055078-75055100 TTTAGGGGCTTTAAAGGTAGAGG + Intergenic
1111452751 13:88440241-88440263 TTGAAGCTCTTTCAGGTTATTGG - Intergenic
1111910500 13:94305974-94305996 TTCCAGGTCTTTCAGGGATGTGG + Exonic
1112679382 13:101744902-101744924 TATAAGGTCTTTGAGGGCAGGGG - Intronic
1113516160 13:110901681-110901703 GTTAAGGTGTTTCAGGATGGAGG - Intronic
1116336103 14:43658593-43658615 CTGAATGTCTTTCAGGGCAGAGG + Intergenic
1116804729 14:49481884-49481906 ATTCAGGTCATTCAGGATAGGGG - Intergenic
1120947213 14:90009523-90009545 TTTAAGTGGTTTCAGGATAGTGG + Intronic
1124901899 15:33831931-33831953 TGTAAGCTCTTTACGGGTAGAGG - Intronic
1124907098 15:33880186-33880208 TTTCAGGTCTTTTTGGGTAGGGG - Intronic
1126465626 15:48958931-48958953 CTGAAGGTCTCTCAGGGAAGGGG - Intronic
1126723561 15:51607551-51607573 TATAAGGTCAATCAGGGCAGAGG + Intronic
1127774095 15:62252170-62252192 TTCCAGATCCTTCAGGGTAGCGG + Intergenic
1129163446 15:73760959-73760981 TTAAAGGCTTTTCAGGGGAGTGG - Intergenic
1133580647 16:7141367-7141389 TTTAAGGTCCATCAGAGAAGGGG - Intronic
1137882530 16:52066515-52066537 TTTAAAGACTTTCAAGGAAGAGG + Intronic
1146380048 17:32321590-32321612 CTTAGGGTCTCTGAGGGTAGAGG - Exonic
1147588672 17:41667293-41667315 TGTAAGCTCTTTCAGGGCACGGG - Intergenic
1148548290 17:48533178-48533200 TTTGAGCTCTTTCAGAGTTGGGG - Intergenic
1149521607 17:57322110-57322132 TTTAAGCTCCATGAGGGTAGGGG + Intronic
1150880545 17:69020953-69020975 TTTATGTTCTTGAAGGGTAGAGG - Intronic
1152120751 17:78416889-78416911 TTTAGGGACTTTCTGGGTTGTGG - Intronic
1152559387 17:81070448-81070470 TTTAAGGTCTGACGGGGCAGAGG - Intronic
1153197050 18:2611841-2611863 TTCAATGTCTTTCAGGGGAGAGG - Intronic
1154935079 18:21046432-21046454 TTAACTGTCTTTCAGGGTTGAGG + Intronic
1157945900 18:51980481-51980503 TATAAGGTCTTTAAGGGAAGGGG + Intergenic
1158501606 18:58007395-58007417 TGTAAGTTCTTTAAGGGAAGAGG + Intergenic
1159779780 18:72647502-72647524 GTTAAAGTCTTTGAGAGTAGGGG + Intergenic
1162120156 19:8460338-8460360 TGGATGGTCTCTCAGGGTAGAGG + Intronic
1166654563 19:44601036-44601058 TTTTAGCTCTATGAGGGTAGGGG - Intergenic
1166817794 19:45557296-45557318 TTTCAGGGCTTTCAGAGCAGGGG + Intronic
1168528455 19:57106715-57106737 TTCAAGGTCTGTCACCGTAGGGG + Intergenic
926852996 2:17221596-17221618 TTTCAGATCCTTCACGGTAGAGG + Intergenic
927235404 2:20869292-20869314 TTTAAGGTTATTCAGGGCTGGGG - Intergenic
928237567 2:29557934-29557956 TTTAAGGGCTCTCAGTCTAGAGG - Intronic
928690458 2:33793560-33793582 TTCAAGTTCATTCAGGGTAGAGG - Intergenic
929129071 2:38548420-38548442 TTTATAGTCTTTCAGTGTACAGG + Intergenic
929359190 2:41063725-41063747 TTTCAGGGTTTTCAGGGTAGTGG + Intergenic
930796022 2:55391929-55391951 TTTAATCTCTTTCAGGCTGGAGG + Intronic
932450816 2:71809631-71809653 TTCAAGGGCTTTTAGGGTAAAGG - Intergenic
932805980 2:74783845-74783867 TTGAAGGTCAGTTAGGGTAGAGG + Intergenic
934746968 2:96765627-96765649 TATAAGCTCCTTGAGGGTAGAGG + Intronic
935631581 2:105216675-105216697 CTTAAGGTCTAGCAGGGAAGTGG - Intergenic
935985730 2:108671347-108671369 TTTAAGGACATTTAAGGTAGAGG + Intronic
936138159 2:109914977-109914999 TTTAAGGACATTTAAGGTAGAGG + Intergenic
936206537 2:110456508-110456530 TTTAAGGACATTTAAGGTAGAGG - Intronic
937680562 2:124640188-124640210 TTTATGGTCTTAGGGGGTAGTGG - Intronic
940653709 2:156462689-156462711 TTTTATGTGTTTCAGGTTAGTGG - Intronic
940947471 2:159634837-159634859 TTTTAAGTCATTCAGGCTAGGGG - Intergenic
943677155 2:190727173-190727195 TTTAATGACTTTCAATGTAGTGG - Intergenic
945665365 2:212734780-212734802 TTTGGGGTCCTTCAGGGTAGAGG - Intergenic
945665792 2:212740310-212740332 TTTAAAATTTTTCAGTGTAGAGG - Intergenic
946789614 2:223286805-223286827 TTTAATTTCTTTCAGTGTAGAGG - Intergenic
1170943223 20:20866389-20866411 TATAAGGTTCTTCAGGGCAGAGG + Intergenic
1171086185 20:22240124-22240146 TCTCAGGAGTTTCAGGGTAGGGG + Intergenic
1172177904 20:32983793-32983815 TTTAATCTCTCTTAGGGTAGGGG + Exonic
1173999126 20:47361425-47361447 TGTAAGATCTTTCAGGGAAGTGG + Intergenic
1175353147 20:58340643-58340665 TTTAAGTTCTTTGAGTGTAGGGG - Intronic
1175359052 20:58392997-58393019 ATTAAGCTCTTTCAGACTAGGGG + Intronic
1176705045 21:10110250-10110272 GTTAAGGACTTTAAGGGAAGGGG + Intergenic
1176929807 21:14795480-14795502 TTTCAGGTCCTTGGGGGTAGGGG - Intergenic
1179003683 21:37489046-37489068 TTTTAGATCTTTCATGGTATAGG - Intronic
1179388067 21:40960896-40960918 CTTAAGGTCTTTCTGTCTAGAGG + Intergenic
1182943690 22:34302156-34302178 TCTAAGTTCTTTGAGAGTAGGGG + Intergenic
951533898 3:23724306-23724328 TTTAGGCTTTTTCTGGGTAGAGG + Intergenic
955740674 3:62088155-62088177 CTTTAGGTGTGTCAGGGTAGAGG + Intronic
959790549 3:110356139-110356161 TTTAAAGACCTTCAGGGAAGCGG + Intergenic
962868905 3:139471052-139471074 TTTAAGGTTATTTTGGGTAGTGG - Intronic
964438943 3:156684348-156684370 TTTAAGGTGTTGCAAAGTAGCGG - Intronic
971052766 4:22879753-22879775 TGTGAGGTCTTTGACGGTAGAGG + Intergenic
976072579 4:81258628-81258650 ATGAAGGTCTTTCTAGGTAGTGG + Intergenic
976316965 4:83668854-83668876 TTAAGGGGCTTGCAGGGTAGTGG - Intergenic
976500819 4:85786995-85787017 TGTAAGCTCTTTGAGGGCAGGGG + Intronic
976954469 4:90878604-90878626 TGTAAAGATTTTCAGGGTAGGGG - Intronic
977891336 4:102314854-102314876 TTTTAGGGCTTACAGTGTAGTGG - Intronic
978092146 4:104730662-104730684 TTTAAGGTCATTCTGGGTAACGG + Intergenic
978778899 4:112529643-112529665 TTTCATGTCCTTAAGGGTAGGGG + Intergenic
979354765 4:119690370-119690392 TTTAAGATTTTTAAGGGCAGAGG + Intergenic
979356620 4:119712893-119712915 CTTATGGTTTTTCAGGGTACAGG - Intergenic
980377304 4:131966920-131966942 GTTAAGGACTTTAAGGGAAGGGG + Intergenic
982227046 4:153175873-153175895 ATTAAGGTATTTCAGAGTAAAGG + Intronic
982591173 4:157313536-157313558 TTTAAGGTCTTTCAGGGTAGGGG + Intronic
983516735 4:168665284-168665306 TGTAAGTTTTTCCAGGGTAGAGG + Intronic
986999868 5:13649530-13649552 TTAAAGGTATTACAGAGTAGAGG - Intergenic
987548300 5:19342829-19342851 TTTAAGATCTTTAATGGTAGTGG + Intergenic
987684613 5:21181522-21181544 CTTGAGGTCTTTCAGGACAGTGG + Intergenic
989574309 5:42975247-42975269 ATTAAGGTATTTGAGGGAAGAGG - Intergenic
989859449 5:46349601-46349623 TTTAAGCTCTTTGAGGCCAGCGG - Intergenic
990052001 5:51513914-51513936 TTTAATGTCTTTCATAGTGGAGG + Intergenic
991124756 5:63057059-63057081 TTAAATGTCTTTAAGGGTATGGG - Intergenic
992988761 5:82261617-82261639 TGAAAGCTCTTTGAGGGTAGGGG - Intronic
995577750 5:113559037-113559059 TTAAAGTTCCTTCAGGGGAGAGG + Intronic
997435205 5:133868960-133868982 TTTAAAGTCTTTAATGGGAGAGG - Intergenic
997567452 5:134900242-134900264 TTTAAGTTGTTTCTGGGTAAGGG + Exonic
1000868527 5:166545932-166545954 TCAGAGGTCTTACAGGGTAGTGG + Intergenic
1000967279 5:167673202-167673224 TTTAAAATCTTTCAGGTTTGGGG + Intronic
1005410118 6:25535826-25535848 TTTGAGCTCTTTCATGGTAAAGG + Intronic
1006953581 6:37846152-37846174 TTTAAGCTGTTTGAGGGTTGAGG + Intronic
1007723714 6:43901445-43901467 TTTAAGGATGTTCCGGGTAGGGG + Intergenic
1009344552 6:62597111-62597133 CTTGGGGTCTTTCAGGTTAGTGG + Intergenic
1009996408 6:70900292-70900314 TTTAAACTATTCCAGGGTAGTGG + Intronic
1013869558 6:114740832-114740854 TTGAAGTTTTTTCAGGGTAGAGG + Intergenic
1014524387 6:122484005-122484027 GTGAAGGTCTTTGAGGGCAGAGG + Intronic
1014743719 6:125175133-125175155 TTTAAGCTCCTTGAGGGCAGGGG + Intronic
1015715071 6:136183968-136183990 TTTAAGGTTTTTTCGGGGAGAGG - Intronic
1022178995 7:27899827-27899849 TTTGAGGTCATTTAGGATAGTGG + Intronic
1022770740 7:33470056-33470078 TGTAAGCTCTTCGAGGGTAGAGG + Intronic
1022774388 7:33510222-33510244 TTTCATATCTTTCAGGTTAGGGG + Intronic
1023243899 7:38179637-38179659 GTTAAAGTCTTTGAGGGTATGGG - Intronic
1025922375 7:65925560-65925582 TTTAAGCTTCTTGAGGGTAGGGG + Intronic
1025932561 7:66008114-66008136 GTTAAGTGCTTTCAGGGCAGAGG - Intergenic
1025950835 7:66144313-66144335 GTTAAGTGCTTTCAGGGCAGAGG + Intronic
1027477257 7:78648681-78648703 TTTAATGTCTACCAGGGTGGAGG + Intronic
1028951858 7:96645283-96645305 TTCAAGGTCTGGCAGGGAAGAGG + Intronic
1030364474 7:108629810-108629832 TTTAAAGTATGTGAGGGTAGAGG + Intergenic
1031360087 7:120838905-120838927 TTTTTCTTCTTTCAGGGTAGAGG - Exonic
1031411356 7:121443093-121443115 ATCAAGGCCTTTCAGGGGAGGGG - Intergenic
1033232043 7:139606890-139606912 TTTATTCTCTTTCAGGTTAGAGG - Intronic
1033509663 7:142046892-142046914 TTTAAGGTCGTTCAGATCAGGGG + Intronic
1033512501 7:142073189-142073211 TTGAAGGTCGTTCAGGTCAGGGG + Intronic
1044108880 8:88247116-88247138 AATGAGGTCATTCAGGGTAGGGG + Intronic
1046159437 8:110341328-110341350 TCAAAGGATTTTCAGGGTAGGGG - Intergenic
1046210607 8:111069548-111069570 TTTAAGGTTTCTTAGGCTAGTGG - Intergenic
1046351219 8:113014747-113014769 ATGAAGGTCTTTCTAGGTAGTGG + Intronic
1048227106 8:132598516-132598538 GGTAAAGTCTTTCAGGGCAGGGG + Intronic
1049516636 8:143062352-143062374 TTCTTGGTTTTTCAGGGTAGAGG - Intergenic
1051384572 9:16494072-16494094 TTTAAGCTCCACCAGGGTAGGGG - Intronic
1052138005 9:24939740-24939762 TTTAAGGAATTTCAATGTAGTGG - Intergenic
1053642302 9:40097305-40097327 GTTAAGGACTTTAAGGGAAGGGG + Intergenic
1053763836 9:41368161-41368183 GTTAAGGACTTTAAGGGAAGGGG - Intergenic
1053968213 9:43683820-43683842 TTTAAGCGCTTTCAGGCTTGTGG + Intergenic
1054323192 9:63694689-63694711 GTTAAGGACTTTAAGGGAAGGGG + Intergenic
1054542451 9:66279340-66279362 GTTAAGGACTTTAAGGGAAGGGG - Intergenic
1056683708 9:88742350-88742372 CTGAAGGTCTTTCAGGGATGAGG + Intergenic
1058351458 9:104029423-104029445 TATAAGTTCTTTCAGAGTGGAGG - Intergenic
1058420265 9:104826794-104826816 TCTAAGCTCTTTAAGGGTAAGGG - Intronic
1059747313 9:117215619-117215641 TGTAAGATCCTTCAGGGCAGAGG + Intronic
1061575946 9:131506243-131506265 TTTGAGGTCCTGAAGGGTAGGGG - Intronic
1202790076 9_KI270719v1_random:80349-80371 GTTAAGGACTTTAAGGGAAGGGG + Intergenic
1189456429 X:41194744-41194766 AGTAAGCTCTTTAAGGGTAGGGG - Intronic
1191649030 X:63516752-63516774 TTTAAAGTCTTTCAAGCTATTGG - Intergenic
1192009115 X:67249368-67249390 TTTAAGTGCTGTCATGGTAGTGG - Intergenic
1192790673 X:74379442-74379464 TTTCAGATCATTTAGGGTAGGGG + Intergenic
1193808594 X:86023931-86023953 TGTAAGGGCTTAAAGGGTAGTGG + Intronic
1197579611 X:128264782-128264804 TTTATGGATTTTCATGGTAGAGG + Intergenic
1198326442 X:135578419-135578441 TTTAACATCTGTCAGGGTTGAGG + Intronic
1198618226 X:138481032-138481054 CTTGAGGCCTTTCAGGGAAGGGG - Intergenic
1200418888 Y:2941818-2941840 TTTAATTTCTTTCAGGGTTTTGG + Intronic
1200939655 Y:8768280-8768302 ATTAAGGTGTTGCAGGGAAGGGG + Intergenic