ID: 982597889

View in Genome Browser
Species Human (GRCh38)
Location 4:157407807-157407829
Sequence CCTGGTATGCAGCTATTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982597889_982597894 23 Left 982597889 4:157407807-157407829 CCAATCAATAGCTGCATACCAGG No data
Right 982597894 4:157407853-157407875 TCAAGAAATGAAACTGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982597889 Original CRISPR CCTGGTATGCAGCTATTGAT TGG (reversed) Intergenic
No off target data available for this crispr