ID: 982598409

View in Genome Browser
Species Human (GRCh38)
Location 4:157414451-157414473
Sequence GCATGAATCCCTTTAGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982598408_982598409 -5 Left 982598408 4:157414433-157414455 CCTGGCTTCTTTCTAATCGCATG No data
Right 982598409 4:157414451-157414473 GCATGAATCCCTTTAGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982598409 Original CRISPR GCATGAATCCCTTTAGCATA TGG Intergenic
No off target data available for this crispr