ID: 982600519

View in Genome Browser
Species Human (GRCh38)
Location 4:157443536-157443558
Sequence CAGTGCCATAGACCACTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982600519_982600527 25 Left 982600519 4:157443536-157443558 CCTGTCAGTGGTCTATGGCACTG No data
Right 982600527 4:157443584-157443606 ACTGACTGGTGACCAGGTGTGGG No data
982600519_982600524 19 Left 982600519 4:157443536-157443558 CCTGTCAGTGGTCTATGGCACTG No data
Right 982600524 4:157443578-157443600 ACTGCCACTGACTGGTGACCAGG No data
982600519_982600523 11 Left 982600519 4:157443536-157443558 CCTGTCAGTGGTCTATGGCACTG No data
Right 982600523 4:157443570-157443592 AACACAGAACTGCCACTGACTGG No data
982600519_982600528 28 Left 982600519 4:157443536-157443558 CCTGTCAGTGGTCTATGGCACTG No data
Right 982600528 4:157443587-157443609 GACTGGTGACCAGGTGTGGGTGG No data
982600519_982600526 24 Left 982600519 4:157443536-157443558 CCTGTCAGTGGTCTATGGCACTG No data
Right 982600526 4:157443583-157443605 CACTGACTGGTGACCAGGTGTGG No data
982600519_982600529 29 Left 982600519 4:157443536-157443558 CCTGTCAGTGGTCTATGGCACTG No data
Right 982600529 4:157443588-157443610 ACTGGTGACCAGGTGTGGGTGGG No data
982600519_982600530 30 Left 982600519 4:157443536-157443558 CCTGTCAGTGGTCTATGGCACTG No data
Right 982600530 4:157443589-157443611 CTGGTGACCAGGTGTGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982600519 Original CRISPR CAGTGCCATAGACCACTGAC AGG (reversed) Intergenic
No off target data available for this crispr