ID: 982600523

View in Genome Browser
Species Human (GRCh38)
Location 4:157443570-157443592
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982600519_982600523 11 Left 982600519 4:157443536-157443558 CCTGTCAGTGGTCTATGGCACTG No data
Right 982600523 4:157443570-157443592 AACACAGAACTGCCACTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr