ID: 982605894

View in Genome Browser
Species Human (GRCh38)
Location 4:157515552-157515574
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982605885_982605894 27 Left 982605885 4:157515502-157515524 CCAACTTTGGGGATGGGCTGGGA No data
Right 982605894 4:157515552-157515574 TACAGCTGGCAGGAGTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr