ID: 982606667

View in Genome Browser
Species Human (GRCh38)
Location 4:157524513-157524535
Sequence CAGGTTAGGAAACCTGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982606661_982606667 30 Left 982606661 4:157524460-157524482 CCAATAACAAGGGCGTCCTGGGT No data
Right 982606667 4:157524513-157524535 CAGGTTAGGAAACCTGTACAGGG No data
982606662_982606667 14 Left 982606662 4:157524476-157524498 CCTGGGTCTGTTAGAAAGTGACA No data
Right 982606667 4:157524513-157524535 CAGGTTAGGAAACCTGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982606667 Original CRISPR CAGGTTAGGAAACCTGTACA GGG Intergenic
No off target data available for this crispr