ID: 982606794

View in Genome Browser
Species Human (GRCh38)
Location 4:157525986-157526008
Sequence GTGGAGCCCTTCAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982606788_982606794 5 Left 982606788 4:157525958-157525980 CCTAATTGGATTACTGGCCTCAG No data
Right 982606794 4:157525986-157526008 GTGGAGCCCTTCAAGAAGGAAGG No data
982606786_982606794 12 Left 982606786 4:157525951-157525973 CCAATCTCCTAATTGGATTACTG No data
Right 982606794 4:157525986-157526008 GTGGAGCCCTTCAAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982606794 Original CRISPR GTGGAGCCCTTCAAGAAGGA AGG Intergenic
No off target data available for this crispr