ID: 982607694

View in Genome Browser
Species Human (GRCh38)
Location 4:157535895-157535917
Sequence TGTACAGGGTGCAGAACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982607685_982607694 3 Left 982607685 4:157535869-157535891 CCTGAGGTCCCTTGAGCCATGCC No data
Right 982607694 4:157535895-157535917 TGTACAGGGTGCAGAACTGTGGG No data
982607686_982607694 -5 Left 982607686 4:157535877-157535899 CCCTTGAGCCATGCCTCCTGTAC No data
Right 982607694 4:157535895-157535917 TGTACAGGGTGCAGAACTGTGGG No data
982607681_982607694 22 Left 982607681 4:157535850-157535872 CCACCATGATTATTAGTACCCTG No data
Right 982607694 4:157535895-157535917 TGTACAGGGTGCAGAACTGTGGG No data
982607682_982607694 19 Left 982607682 4:157535853-157535875 CCATGATTATTAGTACCCTGAGG No data
Right 982607694 4:157535895-157535917 TGTACAGGGTGCAGAACTGTGGG No data
982607680_982607694 29 Left 982607680 4:157535843-157535865 CCTTCTTCCACCATGATTATTAG No data
Right 982607694 4:157535895-157535917 TGTACAGGGTGCAGAACTGTGGG No data
982607684_982607694 4 Left 982607684 4:157535868-157535890 CCCTGAGGTCCCTTGAGCCATGC No data
Right 982607694 4:157535895-157535917 TGTACAGGGTGCAGAACTGTGGG No data
982607687_982607694 -6 Left 982607687 4:157535878-157535900 CCTTGAGCCATGCCTCCTGTACA No data
Right 982607694 4:157535895-157535917 TGTACAGGGTGCAGAACTGTGGG No data
982607679_982607694 30 Left 982607679 4:157535842-157535864 CCCTTCTTCCACCATGATTATTA No data
Right 982607694 4:157535895-157535917 TGTACAGGGTGCAGAACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982607694 Original CRISPR TGTACAGGGTGCAGAACTGT GGG Intergenic
No off target data available for this crispr