ID: 982611489

View in Genome Browser
Species Human (GRCh38)
Location 4:157579659-157579681
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982611489_982611490 -3 Left 982611489 4:157579659-157579681 CCAGTGGGAGGTACAGTTATAAA No data
Right 982611490 4:157579679-157579701 AAACCCCTGCTGCACTATAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982611489 Original CRISPR TTTATAACTGTACCTCCCAC TGG (reversed) Intergenic