ID: 982615097

View in Genome Browser
Species Human (GRCh38)
Location 4:157631607-157631629
Sequence TGTGGGCTGTGATCTGGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982615097_982615102 -5 Left 982615097 4:157631607-157631629 CCCTTACCAGATCACAGCCCACA No data
Right 982615102 4:157631625-157631647 CCACATTTGAATCATCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982615097 Original CRISPR TGTGGGCTGTGATCTGGTAA GGG (reversed) Intergenic
No off target data available for this crispr