ID: 982616151

View in Genome Browser
Species Human (GRCh38)
Location 4:157637978-157638000
Sequence GCGCGGCTGCGCTGCGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 19, 2: 6, 3: 30, 4: 269}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982616151_982616157 2 Left 982616151 4:157637978-157638000 CCCGCGCCGCAGCGCAGCCGCGC 0: 1
1: 19
2: 6
3: 30
4: 269
Right 982616157 4:157638003-157638025 ACCACCACCCGCGGCCACCATGG No data
982616151_982616160 6 Left 982616151 4:157637978-157638000 CCCGCGCCGCAGCGCAGCCGCGC 0: 1
1: 19
2: 6
3: 30
4: 269
Right 982616160 4:157638007-157638029 CCACCCGCGGCCACCATGGCCGG No data
982616151_982616164 11 Left 982616151 4:157637978-157638000 CCCGCGCCGCAGCGCAGCCGCGC 0: 1
1: 19
2: 6
3: 30
4: 269
Right 982616164 4:157638012-157638034 CGCGGCCACCATGGCCGGACGGG No data
982616151_982616163 10 Left 982616151 4:157637978-157638000 CCCGCGCCGCAGCGCAGCCGCGC 0: 1
1: 19
2: 6
3: 30
4: 269
Right 982616163 4:157638011-157638033 CCGCGGCCACCATGGCCGGACGG No data
982616151_982616154 -7 Left 982616151 4:157637978-157638000 CCCGCGCCGCAGCGCAGCCGCGC 0: 1
1: 19
2: 6
3: 30
4: 269
Right 982616154 4:157637994-157638016 GCCGCGCCAACCACCACCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982616151 Original CRISPR GCGCGGCTGCGCTGCGGCGC GGG (reversed) Intergenic