ID: 982628816 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:157805156-157805178 |
| Sequence | AAGAGGGAGCAGAGGAAAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 982628816_982628822 | -1 | Left | 982628816 | 4:157805156-157805178 | CCCTCTTTCCTCTGCTCCCTCTT | No data | ||
| Right | 982628822 | 4:157805178-157805200 | TGAGGCTGCAAGAAGAACACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 982628816 | Original CRISPR | AAGAGGGAGCAGAGGAAAGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||