ID: 982628816

View in Genome Browser
Species Human (GRCh38)
Location 4:157805156-157805178
Sequence AAGAGGGAGCAGAGGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982628816_982628822 -1 Left 982628816 4:157805156-157805178 CCCTCTTTCCTCTGCTCCCTCTT No data
Right 982628822 4:157805178-157805200 TGAGGCTGCAAGAAGAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982628816 Original CRISPR AAGAGGGAGCAGAGGAAAGA GGG (reversed) Intergenic
No off target data available for this crispr