ID: 982631147

View in Genome Browser
Species Human (GRCh38)
Location 4:157830905-157830927
Sequence CTTGTGATGAAATGGGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982631147_982631151 -4 Left 982631147 4:157830905-157830927 CCAGAAACCCATTTCATCACAAG No data
Right 982631151 4:157830924-157830946 CAAGATTTTCTGGACTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982631147 Original CRISPR CTTGTGATGAAATGGGTTTC TGG (reversed) Intergenic
No off target data available for this crispr