ID: 982638746

View in Genome Browser
Species Human (GRCh38)
Location 4:157929731-157929753
Sequence CACTCATACCTTATAGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982638743_982638746 14 Left 982638743 4:157929694-157929716 CCATCAAATGCAAAACCTGGCAG No data
Right 982638746 4:157929731-157929753 CACTCATACCTTATAGAACAGGG No data
982638741_982638746 22 Left 982638741 4:157929686-157929708 CCTGGAAACCATCAAATGCAAAA No data
Right 982638746 4:157929731-157929753 CACTCATACCTTATAGAACAGGG No data
982638744_982638746 -1 Left 982638744 4:157929709-157929731 CCTGGCAGAGAAAGAGACAGTGC No data
Right 982638746 4:157929731-157929753 CACTCATACCTTATAGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982638746 Original CRISPR CACTCATACCTTATAGAACA GGG Intergenic
No off target data available for this crispr