ID: 982639409

View in Genome Browser
Species Human (GRCh38)
Location 4:157938462-157938484
Sequence AAGGGAGACTAAAGAGTTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982639404_982639409 30 Left 982639404 4:157938409-157938431 CCTTTGCTTATATTATGTTAGCG No data
Right 982639409 4:157938462-157938484 AAGGGAGACTAAAGAGTTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982639409 Original CRISPR AAGGGAGACTAAAGAGTTGA CGG Intergenic
No off target data available for this crispr