ID: 982643483

View in Genome Browser
Species Human (GRCh38)
Location 4:157992313-157992335
Sequence AGCGTTCTAGAGATACCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982643481_982643483 -3 Left 982643481 4:157992293-157992315 CCAAGTTAATAAAAACATTGAGC No data
Right 982643483 4:157992313-157992335 AGCGTTCTAGAGATACCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982643483 Original CRISPR AGCGTTCTAGAGATACCAAA GGG Intergenic