ID: 982643483 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:157992313-157992335 |
| Sequence | AGCGTTCTAGAGATACCAAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 982643481_982643483 | -3 | Left | 982643481 | 4:157992293-157992315 | CCAAGTTAATAAAAACATTGAGC | No data | ||
| Right | 982643483 | 4:157992313-157992335 | AGCGTTCTAGAGATACCAAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 982643483 | Original CRISPR | AGCGTTCTAGAGATACCAAA GGG | Intergenic | ||