ID: 982644352

View in Genome Browser
Species Human (GRCh38)
Location 4:158004860-158004882
Sequence TCGAAGAATCCTGAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982644352_982644356 7 Left 982644352 4:158004860-158004882 CCATCCTCCTCAGGATTCTTCGA No data
Right 982644356 4:158004890-158004912 CTCTTTTAAACTACACTTAGAGG No data
982644352_982644357 8 Left 982644352 4:158004860-158004882 CCATCCTCCTCAGGATTCTTCGA No data
Right 982644357 4:158004891-158004913 TCTTTTAAACTACACTTAGAGGG No data
982644352_982644358 12 Left 982644352 4:158004860-158004882 CCATCCTCCTCAGGATTCTTCGA No data
Right 982644358 4:158004895-158004917 TTAAACTACACTTAGAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982644352 Original CRISPR TCGAAGAATCCTGAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr