ID: 982645210

View in Genome Browser
Species Human (GRCh38)
Location 4:158015515-158015537
Sequence CTGGAAAAAGGCTGGTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982645203_982645210 1 Left 982645203 4:158015491-158015513 CCAACAGTTTCTAATTCAGTAGG No data
Right 982645210 4:158015515-158015537 CTGGAAAAAGGCTGGTTTGTGGG No data
982645202_982645210 12 Left 982645202 4:158015480-158015502 CCTGAACTCTACCAACAGTTTCT No data
Right 982645210 4:158015515-158015537 CTGGAAAAAGGCTGGTTTGTGGG No data
982645201_982645210 21 Left 982645201 4:158015471-158015493 CCATCTATTCCTGAACTCTACCA No data
Right 982645210 4:158015515-158015537 CTGGAAAAAGGCTGGTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982645210 Original CRISPR CTGGAAAAAGGCTGGTTTGT GGG Intergenic
No off target data available for this crispr