ID: 982645297

View in Genome Browser
Species Human (GRCh38)
Location 4:158016548-158016570
Sequence GTTATAAGTAAACTAAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982645297_982645301 28 Left 982645297 4:158016548-158016570 CCACTTTTTAGTTTACTTATAAC No data
Right 982645301 4:158016599-158016621 CACCTTCATCTTTTCACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982645297 Original CRISPR GTTATAAGTAAACTAAAAAG TGG (reversed) Intergenic
No off target data available for this crispr