ID: 982649561

View in Genome Browser
Species Human (GRCh38)
Location 4:158070282-158070304
Sequence TCCAAGGATGTGAAGACACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982649555_982649561 23 Left 982649555 4:158070236-158070258 CCCATTTGGATGATTATAATCAA No data
Right 982649561 4:158070282-158070304 TCCAAGGATGTGAAGACACTGGG No data
982649559_982649561 -9 Left 982649559 4:158070268-158070290 CCATGACAAGGATTTCCAAGGAT No data
Right 982649561 4:158070282-158070304 TCCAAGGATGTGAAGACACTGGG No data
982649554_982649561 24 Left 982649554 4:158070235-158070257 CCCCATTTGGATGATTATAATCA No data
Right 982649561 4:158070282-158070304 TCCAAGGATGTGAAGACACTGGG No data
982649556_982649561 22 Left 982649556 4:158070237-158070259 CCATTTGGATGATTATAATCAAA No data
Right 982649561 4:158070282-158070304 TCCAAGGATGTGAAGACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982649561 Original CRISPR TCCAAGGATGTGAAGACACT GGG Intergenic
No off target data available for this crispr