ID: 982674041

View in Genome Browser
Species Human (GRCh38)
Location 4:158355330-158355352
Sequence CCTGTTTAGCACTTTTTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982674038_982674041 -9 Left 982674038 4:158355316-158355338 CCTATTCTTCCTTACCTGTTTAG 0: 1
1: 0
2: 2
3: 15
4: 232
Right 982674041 4:158355330-158355352 CCTGTTTAGCACTTTTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982674041 Original CRISPR CCTGTTTAGCACTTTTTGCC AGG Intronic
No off target data available for this crispr