ID: 982683319

View in Genome Browser
Species Human (GRCh38)
Location 4:158458903-158458925
Sequence CTCTGTCTTTGGAAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2796
Summary {0: 1, 1: 8, 2: 111, 3: 287, 4: 2389}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982683319_982683329 16 Left 982683319 4:158458903-158458925 CCCTCCACTTTCCAAAGACAGAG 0: 1
1: 8
2: 111
3: 287
4: 2389
Right 982683329 4:158458942-158458964 TCACCACCATCATTTGACAGGGG No data
982683319_982683333 27 Left 982683319 4:158458903-158458925 CCCTCCACTTTCCAAAGACAGAG 0: 1
1: 8
2: 111
3: 287
4: 2389
Right 982683333 4:158458953-158458975 ATTTGACAGGGGGTTCTGCCAGG 0: 1
1: 0
2: 0
3: 7
4: 106
982683319_982683327 14 Left 982683319 4:158458903-158458925 CCCTCCACTTTCCAAAGACAGAG 0: 1
1: 8
2: 111
3: 287
4: 2389
Right 982683327 4:158458940-158458962 GGTCACCACCATCATTTGACAGG 0: 1
1: 0
2: 0
3: 7
4: 89
982683319_982683328 15 Left 982683319 4:158458903-158458925 CCCTCCACTTTCCAAAGACAGAG 0: 1
1: 8
2: 111
3: 287
4: 2389
Right 982683328 4:158458941-158458963 GTCACCACCATCATTTGACAGGG 0: 1
1: 0
2: 0
3: 12
4: 123
982683319_982683324 -7 Left 982683319 4:158458903-158458925 CCCTCCACTTTCCAAAGACAGAG 0: 1
1: 8
2: 111
3: 287
4: 2389
Right 982683324 4:158458919-158458941 GACAGAGGAGACTCTCCCTGTGG No data
982683319_982683330 17 Left 982683319 4:158458903-158458925 CCCTCCACTTTCCAAAGACAGAG 0: 1
1: 8
2: 111
3: 287
4: 2389
Right 982683330 4:158458943-158458965 CACCACCATCATTTGACAGGGGG 0: 1
1: 0
2: 1
3: 20
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982683319 Original CRISPR CTCTGTCTTTGGAAAGTGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr