ID: 982683486

View in Genome Browser
Species Human (GRCh38)
Location 4:158459943-158459965
Sequence AAGGAGAGTGCAGTGGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 648
Summary {0: 1, 1: 0, 2: 8, 3: 60, 4: 579}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982683486_982683496 25 Left 982683486 4:158459943-158459965 CCCCCAGCCACTGCACTCTCCTT 0: 1
1: 0
2: 8
3: 60
4: 579
Right 982683496 4:158459991-158460013 ATGCCATACAGCTGCTGCCAGGG 0: 1
1: 1
2: 18
3: 56
4: 243
982683486_982683495 24 Left 982683486 4:158459943-158459965 CCCCCAGCCACTGCACTCTCCTT 0: 1
1: 0
2: 8
3: 60
4: 579
Right 982683495 4:158459990-158460012 CATGCCATACAGCTGCTGCCAGG 0: 1
1: 3
2: 13
3: 36
4: 301
982683486_982683497 26 Left 982683486 4:158459943-158459965 CCCCCAGCCACTGCACTCTCCTT 0: 1
1: 0
2: 8
3: 60
4: 579
Right 982683497 4:158459992-158460014 TGCCATACAGCTGCTGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982683486 Original CRISPR AAGGAGAGTGCAGTGGCTGG GGG (reversed) Intronic
900767735 1:4516445-4516467 AAGGCGAGTGCAGGCACTGGAGG - Intergenic
900865777 1:5267729-5267751 CAGCAGGGTGCAGTGGGTGGAGG - Intergenic
901535099 1:9877513-9877535 AAGACGAGTGCAGGGGCTGGAGG - Intronic
902557917 1:17257914-17257936 GATAAGAGTGCAGAGGCTGGGGG + Intronic
903401746 1:23057869-23057891 GAGGAGACTGCAGTGAGTGGAGG - Intronic
903661744 1:24982692-24982714 CAGGAAAGTGGAGTGGCTGGAGG - Intergenic
903672394 1:25044402-25044424 AAGGAGTGTGGGGTGGCTGTTGG + Intergenic
903759393 1:25687280-25687302 TAGGAGAATCCTGTGGCTGGAGG - Intronic
903945301 1:26959264-26959286 CAGGAGGGTTCAATGGCTGGAGG - Intronic
904081967 1:27877860-27877882 AGGCTGGGTGCAGTGGCTGGTGG + Intronic
904421687 1:30398355-30398377 AAGGAGAGTGAAGTGACCTGGGG + Intergenic
904567435 1:31436027-31436049 GAGGGGAGTGCAGCAGCTGGGGG + Intergenic
905489134 1:38329796-38329818 AAGACTTGTGCAGTGGCTGGAGG + Intergenic
905631042 1:39518707-39518729 AAGGAGAGGGCTGGGGATGGGGG + Intronic
905666718 1:39767469-39767491 AAGGAGAGGGCTGGGGATGGGGG - Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
905885278 1:41488431-41488453 CAGGAGCTTGCAGGGGCTGGGGG + Intergenic
906181248 1:43821550-43821572 AAGCAGAGAGCAGTGACTTGAGG + Intronic
906315993 1:44786728-44786750 AGGGAGAGTGGAGAGCCTGGGGG + Intronic
906666052 1:47622812-47622834 AAGGAGGGAACTGTGGCTGGTGG + Intergenic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907942812 1:59105673-59105695 TAGGAGATAACAGTGGCTGGGGG - Intergenic
908121689 1:60991816-60991838 AAAGAGACTGGTGTGGCTGGAGG - Intronic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909270535 1:73617963-73617985 AGAGACAGTGGAGTGGCTGGGGG - Intergenic
910800391 1:91139059-91139081 AAGGAGAGTCCAGAGAGTGGTGG + Intergenic
911055567 1:93705571-93705593 GAGAAGGGAGCAGTGGCTGGAGG - Intronic
911123952 1:94322971-94322993 GAGGAGACTGCAGGGGCTGCTGG - Intergenic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
912260020 1:108101582-108101604 AAGGCAAGTACAGTGGCAGGAGG + Intergenic
912560514 1:110548242-110548264 AAGGAGTGTGCATTGGCCTGGGG + Intergenic
913562156 1:120032264-120032286 AAGGAGGGAGCTGTCGCTGGTGG - Intronic
913635968 1:120761330-120761352 AAGGAGGGAGCTGTTGCTGGTGG + Intergenic
913997968 1:143667050-143667072 AAGGAGATTTCTGTGTCTGGTGG - Intergenic
914282741 1:146191652-146191674 AAGGAGGGAGCTGTCGCTGGTGG - Intronic
914543771 1:148642368-148642390 AAGGAGGGAGCTGTCGCTGGTGG - Intronic
914622850 1:149428641-149428663 AAGGAGGGAGCTGTCGCTGGTGG + Intergenic
914779697 1:150773997-150774019 GAGGCCAGTGCAGTGGCTTGGGG - Intergenic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
917169557 1:172155913-172155935 CAGTAGAGTGCAGTGACTGAGGG + Intronic
917441584 1:175073620-175073642 AAGGAGAGAGAAGTGGAGGGAGG - Intronic
917869868 1:179231599-179231621 CAGTAGAGTGCAGTGGCTAAGGG + Intergenic
918013638 1:180611172-180611194 AAGAAGAGGGGAGGGGCTGGGGG - Intergenic
918355502 1:183703787-183703809 TAGGAAAAGGCAGTGGCTGGAGG + Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918683788 1:187389522-187389544 AAGGAGAATGCAGTGGCTTTGGG + Intergenic
920136130 1:203770772-203770794 TAGGAGGGTGGAGAGGCTGGAGG - Intronic
920245988 1:204587967-204587989 AATGGAAGTACAGTGGCTGGGGG - Intergenic
920866724 1:209759403-209759425 AAGAAGAGAGCAGTGGGTGCTGG + Intronic
921671437 1:217928178-217928200 AAGGAGGCTGGAGTGCCTGGAGG + Intergenic
922340527 1:224651471-224651493 ATGGAGGGGACAGTGGCTGGAGG - Intronic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922463094 1:225827949-225827971 AAGGACAGAGCAGGGGCTGTGGG + Intronic
922865905 1:228861506-228861528 AAGGAGAGGGCAGTGCCAGCTGG + Intergenic
923118766 1:230970368-230970390 AGGGATGGGGCAGTGGCTGGAGG + Intronic
923352729 1:233125507-233125529 AAGCAGATGGAAGTGGCTGGTGG - Intronic
923660162 1:235950648-235950670 AAGGAGAGCTGAGTGGCAGGAGG + Intergenic
923738253 1:236632313-236632335 AAGGTGGCTGCAATGGCTGGAGG - Intergenic
923742850 1:236671953-236671975 AAGGAGAGTGATTTGGTTGGAGG - Intergenic
924487635 1:244501896-244501918 CAGCAGAGTCCAGTGGCCGGAGG - Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1063937128 10:11089590-11089612 AAAGAGGTTTCAGTGGCTGGTGG + Intronic
1064261622 10:13790821-13790843 TAGCAGAGGGCACTGGCTGGAGG + Intronic
1064319406 10:14288790-14288812 AAGGTGGTTGCAGGGGCTGGAGG - Intronic
1064511166 10:16093799-16093821 AAGGTGGCTTCAGTGGCTGGAGG + Intergenic
1065431559 10:25662055-25662077 AAGGAGAGTGTAGTGACTGTGGG - Intergenic
1066311760 10:34204308-34204330 AAAGAGAGTCCAGTGGCAGTGGG + Intronic
1066485475 10:35838814-35838836 AAGGGTAGTGGAGTGGCGGGGGG - Intergenic
1066575073 10:36816699-36816721 ATGGTGGGTGCAGTGGGTGGAGG + Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067030340 10:42875405-42875427 AAGGAGGGTGCAGTGGGCAGGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067059405 10:43070303-43070325 CAGGGTAGTGCAGGGGCTGGAGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069582704 10:69576399-69576421 GAGGAGCGCGCGGTGGCTGGGGG + Intergenic
1069729679 10:70602620-70602642 AAGGAGAGAGCAGGGATTGGGGG - Intronic
1070569348 10:77629497-77629519 AACGAGAATGCATTGGTTGGGGG - Intronic
1070646291 10:78204456-78204478 AAGGAGAGCCCAGTGGGAGGAGG + Intergenic
1070757359 10:79001657-79001679 CAGGAGGTGGCAGTGGCTGGCGG + Intergenic
1070764188 10:79047183-79047205 TGGGAGAGTCCAGTGGGTGGAGG + Intergenic
1070804241 10:79261382-79261404 AGGGAGAGAGCAGGCGCTGGAGG + Intronic
1071250005 10:83808378-83808400 AAGGAAAGGGCAGTGCCTGTCGG - Intergenic
1073003064 10:100299625-100299647 AAGGAGACTCCAGTGTCTGATGG + Exonic
1073027270 10:100497182-100497204 AGGGAGTGTGGAGCGGCTGGTGG - Exonic
1074887800 10:117708234-117708256 AAGGATTTTGCAATGGCTGGTGG + Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075536317 10:123275035-123275057 AGGGAGGGGGCAGGGGCTGGCGG + Intergenic
1075690471 10:124390521-124390543 CAGGAGAGAGTAGGGGCTGGTGG + Intergenic
1075895318 10:125989969-125989991 GGGGAGTGTGCAGTGGCAGGAGG - Intronic
1075928654 10:126274226-126274248 AATGAGAATGAAGTGGCAGGTGG + Intronic
1076024506 10:127100681-127100703 AAGGAGGGTGGAGAGGCAGGTGG + Intronic
1076212492 10:128659580-128659602 CAGCAGAGTGCAGAGGCTCGAGG - Intergenic
1076546909 10:131251401-131251423 CAGGAGAGAGCAGGGCCTGGGGG - Intronic
1076648523 10:131971110-131971132 AAGGGGAGTCCTGGGGCTGGGGG + Intronic
1077031518 11:470155-470177 ACGGAGAGGGCAGTGGGAGGAGG + Intronic
1077045785 11:544655-544677 AAGGAGGGTGCAGAGGTGGGCGG + Intronic
1077496349 11:2888391-2888413 GAGGAGAATGCAAAGGCTGGTGG - Exonic
1078266049 11:9757053-9757075 GAGGGGAGAGCAGAGGCTGGAGG - Intergenic
1078619078 11:12891342-12891364 CAGGTGAGAGCAGGGGCTGGAGG + Intronic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1080281539 11:30563143-30563165 AAGGAGAGTGGGATGTCTGGGGG - Intronic
1080855348 11:36106978-36107000 AAGGAGAATGCAGTGGCACATGG + Intronic
1080938394 11:36886064-36886086 AGGGAGAGTCCAGTGGCAGCAGG - Intergenic
1081626533 11:44659260-44659282 AAGGATAGAGAAGTGGCTGGAGG + Intergenic
1081688717 11:45060467-45060489 TAAGAGAGGACAGTGGCTGGAGG + Intergenic
1081785667 11:45745186-45745208 ACGGAGGGAGCAGTGGATGGAGG + Intergenic
1081825738 11:46049612-46049634 AAGGAGAGTGCTGTGACAGGTGG - Intronic
1082716616 11:56621591-56621613 AAGGTGGTTGCAGCGGCTGGAGG + Intergenic
1083770915 11:64866923-64866945 ATGGGGAGTGCAGGGGCTGCGGG + Intronic
1083891785 11:65599321-65599343 AGGGAGGGAGGAGTGGCTGGTGG - Intronic
1084477126 11:69395439-69395461 CCAGAGAATGCAGTGGCTGGTGG + Intergenic
1084792122 11:71481570-71481592 AAGGTGGGCACAGTGGCTGGTGG + Intronic
1085197660 11:74682219-74682241 ATGGAGTGTCCTGTGGCTGGGGG - Intergenic
1085316872 11:75550646-75550668 AAGGGGGGTGCCTTGGCTGGTGG + Intergenic
1085381311 11:76121696-76121718 AATGAGAGTGCTATGCCTGGGGG - Intronic
1085400645 11:76233716-76233738 ACAGGGAGTGCAGGGGCTGGGGG + Intergenic
1085465138 11:76717958-76717980 AAGAAGACAGCAGTGCCTGGAGG - Intergenic
1085527052 11:77170376-77170398 AAGGAGGCTGGAGGGGCTGGAGG + Intronic
1086177386 11:83907889-83907911 ACGGAGAGTGGAGGTGCTGGTGG - Intronic
1086540049 11:87898306-87898328 AAGTAGAGTGCAGAGGTTGAGGG - Intergenic
1086902068 11:92379078-92379100 ATGGAGAGAGGAGTGGCAGGGGG - Intronic
1087029126 11:93684715-93684737 AGGGAGAGTCCAGTGGCAGCAGG - Intronic
1088507827 11:110543039-110543061 AAGGAGAGTGTTGTGGCCAGTGG + Intergenic
1088982392 11:114875481-114875503 AAGGAGACAGCATGGGCTGGTGG + Intergenic
1089311374 11:117560359-117560381 AAGGGGACTGCAGTGGCTACAGG - Intronic
1089573736 11:119426516-119426538 AAGGAGGGTGGTTTGGCTGGGGG + Intergenic
1089769493 11:120793203-120793225 AGGCAGAGTGCAGTGGGTCGAGG + Intronic
1090387724 11:126366290-126366312 GAAGAGAGTGCCCTGGCTGGGGG + Intronic
1090529440 11:127575530-127575552 AGGGAGAGTGCAGGAGATGGAGG + Intergenic
1091397831 12:164504-164526 GAGGAGAGTGCAAGGTCTGGAGG - Intronic
1091402023 12:186922-186944 CAGCAGAGGGCAGTGGTTGGGGG - Intergenic
1091664929 12:2412079-2412101 AAGGGCAGTGGAGTGGCAGGTGG - Intronic
1091668334 12:2435247-2435269 AAGGCGATTGCTGGGGCTGGTGG - Intronic
1091767887 12:3133745-3133767 AACCAGAGTGCAGAGGGTGGAGG + Intronic
1092493559 12:8969228-8969250 GAGGAGGGTGCAGTGGCTCCTGG + Intronic
1092999838 12:13983836-13983858 AATGAGAGTGGAGGGGATGGTGG - Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096975856 12:55698985-55699007 AGGGAGGGGGCAGGGGCTGGGGG - Intronic
1097466999 12:59938718-59938740 AGTGAGAGTTCAGTGGCGGGAGG - Intergenic
1097755691 12:63404588-63404610 AATGACAGAGAAGTGGCTGGTGG + Intergenic
1097899388 12:64857899-64857921 TGGGAGAGTGCAGTGACTAGAGG - Intronic
1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG + Intergenic
1098931802 12:76425566-76425588 AAAGATGGTGCAGTGGCAGGGGG - Intronic
1099557669 12:84129360-84129382 AAGGAGAATGCAGTGGCGCCTGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1101403115 12:104405244-104405266 AAGCAAGGTGCAGTGGGTGGAGG - Intergenic
1101939875 12:109091937-109091959 AAGGAGAGTCCAGGTGCTGCTGG - Intronic
1102016890 12:109654147-109654169 AAGGAGATAGCTGAGGCTGGGGG + Intergenic
1102356582 12:112241909-112241931 AGAGAGGGTTCAGTGGCTGGAGG - Intronic
1102591268 12:113958486-113958508 AAGGAAAGTGCATGGGCTTGAGG - Intronic
1102821760 12:115914714-115914736 AAGCAGAGTGGGGTGGCCGGGGG + Intergenic
1103321142 12:120093499-120093521 AAGGAGGCAGCAGTGCCTGGGGG - Exonic
1103948218 12:124538677-124538699 CAGGAGAGTGATGTGGCGGGCGG + Intronic
1104112367 12:125716182-125716204 AAGGATAGTGAAGTGGTGGGAGG + Intergenic
1104198059 12:126560474-126560496 AAAGAGACTGCAGTGGATTGAGG - Intergenic
1104437196 12:128765753-128765775 AAGGAGGGTGGAGTGGCTGGGGG - Intergenic
1104477811 12:129084776-129084798 AAGGGAAGTGCCCTGGCTGGTGG + Intronic
1104789556 12:131473123-131473145 AAGGATAGTGCCCTGGATGGGGG + Intergenic
1104958643 12:132477823-132477845 CAGGAGAGTGCTGGGGGTGGCGG - Intergenic
1105764405 13:23545133-23545155 AGGGAGGGTGTGGTGGCTGGGGG - Intergenic
1106141061 13:27012066-27012088 AAGGAGAGTGAAGTGAATGGAGG + Intergenic
1106197977 13:27510278-27510300 AAGCAGAGGACAGTGGCTGCAGG - Intergenic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1106406656 13:29480525-29480547 AAGGAGGCCACAGTGGCTGGAGG - Intronic
1106814046 13:33387650-33387672 AGGGACAGTGCAGTGGCAGCAGG + Intergenic
1106866864 13:33974073-33974095 AATAAGAGTGCAGAGGCTGAGGG + Intergenic
1106906448 13:34414468-34414490 ATGGAGCATGCAGTGGCAGGTGG + Intergenic
1107600904 13:42011736-42011758 CAGGAGTTTGCAGTCGCTGGAGG + Intergenic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108357461 13:49640841-49640863 AAGGAGGGTGCCTTGGCTGATGG + Intergenic
1110464989 13:75790216-75790238 GGGGACAGGGCAGTGGCTGGAGG - Intronic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1110717390 13:78721569-78721591 AAGCAGGGTGCATGGGCTGGAGG - Intergenic
1111947706 13:94682869-94682891 AAGGAGATTGTAGTGTTTGGTGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113594088 13:111519252-111519274 AAGGTGAGTCCAGAGGCTGCCGG - Intergenic
1113966709 13:114156609-114156631 AAGGACAGGGCAGAGGCTGGTGG - Intergenic
1114522296 14:23347130-23347152 AAGGAGGGTGCTGAGGATGGCGG + Exonic
1114595673 14:23909693-23909715 AAGGAGAGTGCTGTGTGTTGAGG - Intergenic
1114985249 14:28218210-28218232 AAGGAGAGTGCAGCAACTGCAGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1116402427 14:44524506-44524528 AAGAAAACTGCTGTGGCTGGAGG + Intergenic
1116888951 14:50249001-50249023 AGGGAGGGTACAGTGGCTGGGGG + Intronic
1117052187 14:51872021-51872043 CAGGTGAGTGCAGTGGTTGAAGG + Intronic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1118506815 14:66422595-66422617 AAAAATAGTGCAGTAGCTGGAGG - Intergenic
1118768901 14:68928813-68928835 CAGGAGAGTTTGGTGGCTGGGGG - Intronic
1118991337 14:70799762-70799784 AAAGAGAGTGAAGTCCCTGGGGG + Intronic
1119773432 14:77235436-77235458 AGGGGGACTGCAGTGGGTGGGGG + Intronic
1119773489 14:77235612-77235634 AGGGGGACTGCAGTGGGTGGGGG + Intronic
1120561951 14:86005904-86005926 AAGAAGGGTAGAGTGGCTGGTGG - Intergenic
1120625976 14:86827049-86827071 CAGGAGAGGGCAGGGGGTGGGGG + Intergenic
1121441986 14:93955284-93955306 TGGGAGAGTGCAGGGGCTGGTGG - Intronic
1121883159 14:97518242-97518264 AAGGAGAAAGCAGTTGCTGAAGG - Intergenic
1121945663 14:98119360-98119382 AAAGAGAGAGAAGTGGCAGGTGG + Intergenic
1122054283 14:99082013-99082035 AGGGACAGTGCAGGGGGTGGGGG + Intergenic
1122271719 14:100571257-100571279 GAGGAGAGAGCAGGGGCTAGTGG - Intronic
1124856135 15:33391137-33391159 AAGCAGAGTGGTGGGGCTGGAGG - Intronic
1126277865 15:46905643-46905665 CAGGAGAGTGCAGTGTATAGGGG + Intergenic
1126452453 15:48823566-48823588 AGGGAGAATGCAGTGCCTTGGGG - Intergenic
1126477362 15:49079707-49079729 AAGGAGAGTGGTGTGGATGGGGG - Intergenic
1127324645 15:57883447-57883469 AAGGAGACTGGAATGGCAGGTGG + Intergenic
1127456395 15:59159468-59159490 AAGGAGACTGGAGTGTCAGGAGG + Intronic
1128212421 15:65912036-65912058 AATGAGAGGGCAGTGAGTGGGGG + Intronic
1128267677 15:66280846-66280868 AAGCAGCCTGGAGTGGCTGGTGG - Intergenic
1128745252 15:70109954-70109976 AAGGAGAATGCAGAGGTGGGTGG + Intergenic
1128923678 15:71634605-71634627 GAACAGAGAGCAGTGGCTGGGGG + Intronic
1129258396 15:74347828-74347850 GTGGAGAGGGCAGAGGCTGGGGG - Intronic
1129298959 15:74614806-74614828 AAGGAGGGGGCGGTGCCTGGAGG + Intronic
1129907524 15:79199203-79199225 AAGGGTAGTGAAGGGGCTGGGGG - Intergenic
1131051951 15:89354222-89354244 AAGGAGGTTGCAGGTGCTGGGGG + Intergenic
1131396859 15:92093180-92093202 AAGGAGATTCGAGTGGCTCGGGG + Intronic
1131529365 15:93178975-93178997 AAGTAGATTGCACTGGGTGGGGG + Intergenic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1132090334 15:98943087-98943109 GTGGAAAGTGCAGAGGCTGGGGG - Intronic
1132537169 16:488022-488044 GAGGAGTGTGAAGAGGCTGGAGG + Intronic
1132888412 16:2192731-2192753 AAGGAGGTTGACGTGGCTGGTGG - Intronic
1133680603 16:8116378-8116400 AAGGATAATTCAGTGGGTGGGGG - Intergenic
1134053608 16:11155358-11155380 GAGGAGAGTGCCGTGGCTCTGGG - Intronic
1134339195 16:13329487-13329509 AAGGAAAATGATGTGGCTGGAGG - Intergenic
1135265664 16:21023654-21023676 AATGAGATTGCAGAGGCAGGCGG + Intronic
1135650054 16:24198044-24198066 TCGGAGGGTGCAGTGGCTGAGGG + Intronic
1135821284 16:25688753-25688775 AAGGACAGTACAGTGTGTGGTGG - Intergenic
1136100181 16:27988765-27988787 AAGGAGAGGGCTGGGCCTGGTGG + Intronic
1136122328 16:28146598-28146620 ATGGAAAGAGCATTGGCTGGGGG - Intronic
1136858852 16:33683024-33683046 ATGGTGATTGCAGGGGCTGGGGG + Intergenic
1136922410 16:34343974-34343996 AGGGAGTGTGCAGTGGTGGGGGG - Intergenic
1136982163 16:35067832-35067854 AGGGAGTGTGCAGTGGTGGGGGG + Intergenic
1138550234 16:57743870-57743892 AAGGAGAGGGCTGTGGCGGTTGG - Intronic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1141621446 16:85238589-85238611 AGGGGGAGTGCAGAGGCTGGCGG - Intergenic
1203120426 16_KI270728v1_random:1531518-1531540 ATGGTGATTGCAGGGGCTGGGGG + Intergenic
1142760015 17:2036630-2036652 AGGGCAAGGGCAGTGGCTGGGGG - Exonic
1143141507 17:4744110-4744132 AAGGAGAGCGGAGTGGGGGGTGG + Intronic
1144316769 17:14069448-14069470 AAGGAGAGCGTGGTGTCTGGAGG - Intergenic
1144677065 17:17168484-17168506 AAGGGGACAGGAGTGGCTGGAGG - Intronic
1145246659 17:21274050-21274072 AGGGTGGGTGCAGTGGCTTGGGG - Intergenic
1145943624 17:28757677-28757699 AGGGCAAGTGCAGTGGCTGTGGG + Exonic
1146472063 17:33132444-33132466 AAGCAGAGTGAGGTGGCTGGGGG + Intronic
1146590692 17:34125930-34125952 AAGGGGAGTGACGTGGATGGGGG - Intronic
1147450700 17:40502159-40502181 AAGGAGGCTGAAGTGTCTGGAGG + Intergenic
1148107077 17:45124448-45124470 AAGGAGGGTGCAGTCCCAGGCGG + Intronic
1148124852 17:45231316-45231338 AGGGAGGCTGCAGAGGCTGGGGG + Intronic
1148541178 17:48481893-48481915 AATGAGAGTGGAGTGGGAGGTGG + Intergenic
1148667722 17:49387281-49387303 AAAGTGAGTGGTGTGGCTGGGGG - Intronic
1150919825 17:69470896-69470918 AAGGAGTGTGCATTGGGAGGTGG - Intronic
1150986870 17:70208107-70208129 AAGAAGACTGCAGTGGTTTGTGG + Intergenic
1151147390 17:72053720-72053742 AAGGAGGCTGGTGTGGCTGGTGG - Intergenic
1151195768 17:72430322-72430344 GAGGAGAAAGCTGTGGCTGGAGG - Intergenic
1151213062 17:72559239-72559261 CAGAACAGTGCAGTGGCTGCTGG - Intergenic
1151334958 17:73434325-73434347 AAGGAGAGTGCAAAGCCAGGAGG - Intronic
1151558382 17:74858657-74858679 GAGGAGGGAGCAGTGGCTGGAGG - Intronic
1151657979 17:75504465-75504487 CAGCAGAGGGCAGTGGCTGGAGG + Exonic
1151715331 17:75828120-75828142 GGGGAGAGGGCAGTGCCTGGTGG + Intronic
1151766348 17:76135307-76135329 AAGGAGAGGGGAGTTGCTTGCGG + Intergenic
1152206835 17:78978699-78978721 CAGCAGAGTGAAGTGGCTGGGGG - Intronic
1152259495 17:79259422-79259444 AAGGTGAGGGCAGGGGCAGGAGG + Intronic
1152635658 17:81429599-81429621 AAGGGGAGTGAGGTGGGTGGGGG + Intronic
1153515653 18:5898298-5898320 AAGGTGTGTGCAGAGGCAGGAGG - Intergenic
1154075078 18:11192475-11192497 CAGGACAGTGCAGTAGGTGGGGG - Intergenic
1157157856 18:45285391-45285413 AAGTATAGTGCAGTGACTGATGG - Intronic
1157275461 18:46308146-46308168 AAGGAGAGTGCAATGGATATTGG - Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1158430628 18:57383175-57383197 AGGAATAGTGCAGTGGCCGGGGG - Intergenic
1158437359 18:57442821-57442843 AAGGAGAGTGAAGCAGCTGCTGG - Intronic
1158513672 18:58113534-58113556 AAGGACACTGTGGTGGCTGGAGG + Intronic
1158716482 18:59884797-59884819 AAGGAGAATGGAGTGGTTGGTGG - Intergenic
1158960936 18:62587288-62587310 ATGGAGAGTGCGCTGGGTGGGGG + Intronic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1160693128 19:469266-469288 CTGGAGAGTGCAGTGGCTCATGG + Intronic
1160827676 19:1088382-1088404 CAGGAGGAAGCAGTGGCTGGTGG + Exonic
1160872067 19:1282188-1282210 GAGGAGGGTGCAGAGGATGGGGG + Intergenic
1161412987 19:4127291-4127313 TAGGTGAGTGCAGTGGCTCACGG - Intergenic
1161821895 19:6534799-6534821 CAGCAGAGCGCAGTGGCTGCAGG - Exonic
1162135005 19:8550078-8550100 AAGCTGAGTGCAGTGGCTCACGG - Intronic
1162337668 19:10071571-10071593 ATGGAGGGTGCAGGGGTTGGGGG - Intergenic
1162379128 19:10321481-10321503 AAGGAAGGGGAAGTGGCTGGGGG + Intronic
1163184081 19:15624092-15624114 ATGGTGAGTGCAGGTGCTGGTGG + Exonic
1163189877 19:15669823-15669845 ATGGTGAGTGCAGGTGCTGGTGG + Intergenic
1163767342 19:19170893-19170915 AAGGAGAGGGAAGTGGTTGGTGG - Intronic
1165424162 19:35736834-35736856 GGGGGGAGTGCAGTGGCAGGAGG + Intronic
1166372541 19:42310195-42310217 AAGGGGAGTACAGGGGCAGGAGG - Intronic
1167135456 19:47612876-47612898 AAGGAGGGGACAGTGGCTGCGGG - Intronic
1167191855 19:47995925-47995947 AACGAGAGGGCAGAGGCTGTGGG + Intronic
1167793469 19:51694446-51694468 AGGGAGGGAGCAGGGGCTGGGGG - Intergenic
1167990541 19:53357249-53357271 AAGGAGGTTGCAGTGAGTGGAGG + Intergenic
925397336 2:3544566-3544588 AAGAAGAGGGCTGTGGCTGGAGG + Intronic
925536860 2:4927219-4927241 CAGGGGAGTGGAGTGGCTGTTGG + Intergenic
925628707 2:5867301-5867323 GAGGAGGGTGCAGTGTCTGGTGG + Intergenic
925786259 2:7434118-7434140 TAGGAGTGTGCAGTGGATGTGGG + Intergenic
925883176 2:8369843-8369865 AAGGAGAGGCCAGTGGCTGATGG - Intergenic
926891732 2:17644545-17644567 AAGGAGACTGCAGTTGGTGCTGG + Intronic
927144277 2:20151401-20151423 ATGCAGGGTGCAGGGGCTGGCGG + Intergenic
927905297 2:26850715-26850737 AAGGACTGTGCTGTGGCTGTTGG + Intronic
927962164 2:27247619-27247641 AATGAGGGGGCATTGGCTGGTGG + Intergenic
929011119 2:37446066-37446088 TGGCAGAGTGCAGGGGCTGGGGG + Intergenic
929019053 2:37532339-37532361 AAGTGCAGGGCAGTGGCTGGAGG + Intergenic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
929601574 2:43207825-43207847 CATGAGTGTGCAGTGGCAGGAGG + Intergenic
929760423 2:44801996-44802018 AAGGAAAGGGCGGTGGCTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930731803 2:54734984-54735006 AAGGTGTGTGATGTGGCTGGAGG - Intronic
930751941 2:54942964-54942986 AAGAAGAGTGGAGAGGCAGGTGG - Intronic
932415035 2:71568384-71568406 AAGGAGGGTGCAGTCCATGGTGG - Intronic
932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG + Intronic
932702300 2:74000249-74000271 AAGGAGGGTGGAGAGGCAGGGGG - Intronic
932768553 2:74487066-74487088 AAGGACACTGCTGTGGCTGGAGG + Intronic
933351545 2:81158734-81158756 ATGGAGAGAGCAGTGACTGCGGG + Intergenic
933770502 2:85741226-85741248 ATGGAGTCTGCAGTGGCTGTCGG - Intergenic
935437954 2:103056898-103056920 AGGGAGAGTGCCGTGACTAGGGG - Intergenic
935662841 2:105484860-105484882 GGGGAGAGTCCAGTGGCGGGGGG - Intergenic
935679155 2:105621040-105621062 AATGGGAGTGCAGAGGCTGAAGG - Intergenic
935835671 2:107050630-107050652 ATGGAGAGTGCAGCCACTGGGGG - Intergenic
936641539 2:114317355-114317377 AAGGAGAGCTCAGCGACTGGGGG - Intergenic
937613670 2:123893905-123893927 AGGGAGAGTGCAGATACTGGGGG - Intergenic
937876336 2:126828210-126828232 AAGGAGAGTGGAGGGGAAGGAGG - Intergenic
937924312 2:127156100-127156122 AAGGAGTGTCCAGTTGCTCGTGG - Intergenic
937929156 2:127191485-127191507 CGGGAGGGTGCAGTGGCTGCGGG + Intronic
937973191 2:127565658-127565680 AAGGAGAGGGCAGAGGATGATGG - Intronic
940041517 2:149366562-149366584 AAGAAGAGTCCAGGGACTGGGGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941157259 2:161994919-161994941 AAGGGGAGGGAAGTTGCTGGTGG - Intronic
942115074 2:172720864-172720886 GAGGGGAGTGCAGTTGCTGAAGG - Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945039006 2:205728889-205728911 AAGGAGAGTGTGATGTCTGGGGG + Intronic
945944295 2:215980183-215980205 CAGGAGAAAGCAGTGCCTGGAGG - Intronic
946059319 2:216928085-216928107 AAGGAGAGTGGAGTGGTTAAGGG - Intergenic
946407392 2:219498890-219498912 AAGGAGCTTGCAGTAGCGGGCGG + Exonic
946507612 2:220318271-220318293 TAGGAGACTGCAGAGGCTAGAGG + Intergenic
946762524 2:223008879-223008901 AAGAAGAGAGAAGAGGCTGGAGG - Intergenic
946968819 2:225069112-225069134 CAGGAGAGTGAAGTGAATGGGGG - Intergenic
947812270 2:233011923-233011945 GAGGAGAGTGCGGTGGAGGGAGG + Intronic
948094747 2:235324672-235324694 AAGGAGGGAGCTGGGGCTGGGGG + Intergenic
948603088 2:239118469-239118491 GAGGAGAGTGCAGCGGTGGGTGG + Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
948814252 2:240501920-240501942 AAGGAGAGTGAAGACGATGGGGG - Intronic
948831015 2:240598261-240598283 AAGGAGAGTCTAGTGGGAGGTGG + Intronic
949011371 2:241680975-241680997 AAGAAGAGAGCAGAGGATGGTGG + Intronic
949032781 2:241804861-241804883 AAGGAGGCTGGAGTGGTTGGGGG + Intergenic
1168729255 20:62535-62557 AAGTGGAGTGCAGTGGCATGGGG - Intergenic
1169905638 20:10600485-10600507 AAGGAGACAGCAGTGGTTGATGG + Intronic
1170024264 20:11871986-11872008 AGGGAGTGTGCAGAAGCTGGGGG - Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170571733 20:17636557-17636579 AAGGTGGGTGTAGTGGCTGGCGG - Exonic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171147980 20:22802493-22802515 AAGGAAAGGACAGTGGCAGGAGG + Intergenic
1171343607 20:24449050-24449072 AGGGTGAGTGCAGGAGCTGGGGG - Intergenic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172016643 20:31879574-31879596 AAGGAAAGTGCAGTTGGAGGCGG + Intronic
1172628124 20:36360452-36360474 CAGGAGTCTGCAGAGGCTGGAGG - Intronic
1173471948 20:43330698-43330720 AAACAGAGTGCACTGCCTGGTGG - Intergenic
1174049288 20:47756711-47756733 AAGGAGGTTGCAGTGAGTGGAGG - Intronic
1174625734 20:51912911-51912933 AAGGAGGCTGGTGTGGCTGGAGG - Intergenic
1175207345 20:57321612-57321634 AAGGAGAGTGCAGTGTGGGGAGG - Intergenic
1175801670 20:61804546-61804568 AAGGAGAGGGCAGGACCTGGAGG - Intronic
1175853605 20:62107069-62107091 AAGGAGACCAGAGTGGCTGGAGG - Intergenic
1175936873 20:62518039-62518061 AAGGAGACCTCACTGGCTGGGGG - Intergenic
1175940116 20:62533899-62533921 GAGGAGGGTGCAGTGTCTGTGGG + Intergenic
1176310625 21:5147072-5147094 AAGGGCAGTGCAGGGGCAGGAGG + Intronic
1178365539 21:31986346-31986368 AGAGAGAGTGCAGGGGTTGGAGG - Intronic
1178705885 21:34872391-34872413 CAGGGATGTGCAGTGGCTGGAGG - Intronic
1178758609 21:35378253-35378275 CAGGATAGTGCAATGACTGGAGG + Intronic
1179585346 21:42370843-42370865 AAGGAGTTGGCGGTGGCTGGAGG - Intergenic
1179585389 21:42371043-42371065 AGGGTGTGGGCAGTGGCTGGAGG - Intergenic
1179585528 21:42371653-42371675 AGGGAGTGAGCAGTGGCCGGAGG - Intergenic
1179846430 21:44114963-44114985 AAGGGCAGTGCAGGGGCAGGAGG - Intronic
1179959940 21:44762545-44762567 AAGGAGGGTTACGTGGCTGGTGG + Intergenic
1180071224 21:45436728-45436750 AAGGAGGGAGCCGTGGCTGTGGG + Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1180908111 22:19430340-19430362 AAGGAGAGAGAGGTGGCAGGAGG + Intronic
1181632921 22:24160810-24160832 AAGCAGGGTGAAGTGCCTGGGGG - Intronic
1181725887 22:24810646-24810668 GGGGAGAATGCAGGGGCTGGTGG + Intronic
1182320880 22:29478148-29478170 AAGGAGAGTGCGCTGGGAGGAGG - Intergenic
1182552407 22:31107341-31107363 AACGATAGTGCCGGGGCTGGAGG + Intronic
1182888573 22:33797225-33797247 AAGGCGAATGAACTGGCTGGAGG - Intronic
1183059902 22:35329949-35329971 AAGGCTTGTGCAGGGGCTGGAGG + Intronic
1183737447 22:39651670-39651692 AAGGACAGTGCCGGGGCTCGAGG - Intronic
1184717531 22:46290467-46290489 TAGGAGGGTGGCGTGGCTGGAGG + Intronic
1184717552 22:46290552-46290574 TAGGAGGGTGGTGTGGCTGGAGG + Intronic
1184717560 22:46290583-46290605 TAGGAGGGTGGCGTGGCTGGAGG + Intronic
1184827983 22:46965988-46966010 CAGGAGAGTGCCATGGCTGCGGG - Intronic
1185196159 22:49470745-49470767 AAGGAGAGGGAGGTGCCTGGCGG + Intronic
1185226773 22:49657864-49657886 CAGGAGATGGCAGGGGCTGGAGG - Intergenic
1185233030 22:49694152-49694174 CAGGTGAGTGCAGGGGCTGGAGG - Intergenic
949584092 3:5420831-5420853 AAGGAGAGTAAAATGGCTTGTGG + Intergenic
950429799 3:12944212-12944234 AAGGAGGCTGCTGTGGGTGGGGG - Intronic
950443328 3:13022432-13022454 CAGGAGACAGCAGTGGCTGCAGG + Intronic
950532824 3:13562800-13562822 ATGGTGGGTGCAGGGGCTGGAGG - Intronic
950632278 3:14290391-14290413 AAGTAGAGTGAGGTGGTTGGAGG - Intergenic
951255053 3:20439051-20439073 AAGGAGAGGACAATGACTGGGGG + Intergenic
952224258 3:31358068-31358090 AAGGGGAGGGCAGTGGATGAAGG + Intergenic
953019688 3:39105544-39105566 TAGGAGAGGGCAGTGGTTAGGGG - Intronic
953339129 3:42119028-42119050 AAGGAGAGAGCAGCAGCCGGTGG - Intronic
953461925 3:43088455-43088477 AGGAAGAGGGCAGTGGCTGCTGG - Intronic
953643941 3:44736183-44736205 AAGGAGAGAACAGTGTCTTGGGG + Exonic
953899494 3:46831706-46831728 AGGGAGATTGCACTGCCTGGGGG - Intronic
954493591 3:50930942-50930964 CAGGAGAGGGCAGTGACTTGGGG + Intronic
954557946 3:51532989-51533011 TAGGAAAAGGCAGTGGCTGGAGG + Intergenic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
955867923 3:63405120-63405142 AAGGACAGAGGAGTAGCTGGAGG - Intronic
956733390 3:72217276-72217298 AAGTAGAGTGGAATGGATGGTGG - Intergenic
957486029 3:80864337-80864359 AAGGGGAGTGCAGGGGTTGTGGG + Intergenic
957950704 3:87122309-87122331 CAGGAGAGTCCAGTGGCAGCAGG - Intergenic
959090767 3:101900271-101900293 AAGGAGAGGGGAGAGGCTGAGGG + Intergenic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
961390383 3:126549084-126549106 AAGGAGCGTGGTGTGGCTGCTGG - Intronic
961649061 3:128408454-128408476 TGGGAGTGTGCAGGGGCTGGAGG - Exonic
961964544 3:130888635-130888657 AGGGAGAGTGCAGTGGCTAGTGG - Intronic
962352034 3:134663444-134663466 AAGGATAAGGCAGAGGCTGGGGG + Intronic
962927697 3:140010699-140010721 TTGGGGAGTGCAGTGGATGGTGG - Intronic
963951704 3:151209016-151209038 AAGTGGAGTGAAGTGGCTAGTGG + Intronic
965403756 3:168245960-168245982 AGGGAGAGTGAAGTGGCATGTGG + Intergenic
966068225 3:175842283-175842305 AAGTAGTATGGAGTGGCTGGAGG - Intergenic
966899453 3:184469742-184469764 AAGGAAAGTACAGCAGCTGGAGG + Intronic
967585177 3:191204602-191204624 AAAGAGACCGCAATGGCTGGAGG + Intronic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967934677 3:194717401-194717423 AAGGATGGTGCAGTGGCGGCAGG + Intergenic
968005120 3:195237362-195237384 AAGGAGAGTGCAGCAGTTGTGGG - Intronic
968597078 4:1491189-1491211 CAGGACAGGGCAGTGCCTGGCGG + Intergenic
968619040 4:1595403-1595425 AAGGGGCATGCAGAGGCTGGGGG + Intergenic
968642083 4:1720008-1720030 GTGGGGTGTGCAGTGGCTGGAGG - Intronic
968832970 4:2942742-2942764 AAGGAAAGTGGAGGGGCAGGAGG + Intronic
968866936 4:3219074-3219096 AAGAAGAGGCCAGTGCCTGGCGG + Intronic
968887464 4:3342009-3342031 AAGGAGAGGGGAGAGGCGGGAGG + Intronic
969281132 4:6171329-6171351 GAGGAGGGTGCTGGGGCTGGTGG - Intronic
969525752 4:7703252-7703274 GAGGAGAGTGGTGTGGCTGAGGG - Intronic
969963621 4:10972066-10972088 AAGGAAAGAACAGTGGCTAGAGG - Intergenic
970140336 4:12975164-12975186 AAAGATAGTGCACTGGCTGGAGG - Intergenic
970442356 4:16092789-16092811 AGAGAGAGCACAGTGGCTGGGGG + Intergenic
972386837 4:38575108-38575130 ATGGAGAGTCCAGTGGCCAGCGG - Intergenic
973786506 4:54337455-54337477 AAGGAGACAGAAGGGGCTGGAGG - Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974266905 4:59597704-59597726 AAGGATAGTGCAGGGACTGTGGG + Intergenic
977325803 4:95573082-95573104 AAGGAAAGTGCAGTGACTGGAGG - Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979675328 4:123403068-123403090 AAGGAGAGGGCAGTGGTTAAAGG - Exonic
979935366 4:126687515-126687537 AAGGAGAGAGCTGTGGAAGGGGG - Intergenic
981871197 4:149487737-149487759 AAGGAGAGTGCAGTGACTAGGGG - Intergenic
982683486 4:158459943-158459965 AAGGAGAGTGCAGTGGCTGGGGG - Intronic
982932570 4:161428075-161428097 AAGGAGAGTGCAGTGGTTTTAGG + Intronic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983711195 4:170718418-170718440 GAGGAGAATGCAGTGGCTCCAGG + Intergenic
984139563 4:175986389-175986411 AAGTTGGGTGCAGTGGCTGTGGG + Intronic
984760700 4:183360277-183360299 AAGGACATTCCAGGGGCTGGAGG + Intergenic
985424080 4:189811729-189811751 AAGGACAGGGCTGTGGCAGGAGG - Intergenic
985723405 5:1502470-1502492 CAGGAGAGTGAACTGGCGGGAGG + Intronic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986089757 5:4492818-4492840 TAGGAAAGGGCAGTGGCTGCTGG - Intergenic
986301869 5:6483839-6483861 GAGGACAGTGCATTGGGTGGTGG - Intronic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
986795396 5:11205854-11205876 AAGCACATTGCAGTGACTGGAGG + Intronic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
988697985 5:33643263-33643285 AAGGGAAGAGCAGTGGATGGAGG - Intronic
988700104 5:33665216-33665238 AAGCAGAGATCAGGGGCTGGGGG + Intronic
990185519 5:53205889-53205911 TAGGAAAAGGCAGTGGCTGGAGG - Intergenic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991449836 5:66740217-66740239 AAAGAGACAGCAGAGGCTGGTGG + Intronic
992404753 5:76446612-76446634 AAGTAGAGTGCAAAGGATGGGGG - Intronic
993013630 5:82511206-82511228 AGGGAGACTGGAGAGGCTGGTGG + Intergenic
993107114 5:83612054-83612076 AAGGAGACTTCAGTGCCTGTGGG + Intergenic
993233462 5:85270127-85270149 GGGGAGAGGGCAGGGGCTGGAGG - Intergenic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993416378 5:87638500-87638522 AGGGAGGGTGAAGTGGGTGGGGG + Intergenic
994217974 5:97159917-97159939 ATGAAGAGTGCAGTGACTGTGGG - Intronic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG + Intergenic
997641069 5:135449327-135449349 TAGCAGAGTGCACTGTCTGGGGG + Exonic
997647343 5:135490131-135490153 CAGGAGAGTGCGGTGGCTCGGGG + Intergenic
998201517 5:140127321-140127343 GGGGAGTGTGCACTGGCTGGAGG + Exonic
999073003 5:148767636-148767658 AAGAAGACTGGAGTGGGTGGAGG + Intergenic
999078123 5:148816822-148816844 AAGGAAAGTGCTGTGAATGGAGG + Intergenic
999079148 5:148826795-148826817 CAGGTGAGCGCACTGGCTGGGGG - Exonic
999254705 5:150203882-150203904 GAGGAGAGAGGAGGGGCTGGGGG - Intronic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1001496252 5:172189219-172189241 AAGGAGAGTGCTGGGGGTGGGGG + Intergenic
1001537198 5:172506495-172506517 AAGGAGACTGAAGAGGCAGGAGG - Intergenic
1001822057 5:174718268-174718290 AAGGAGAGGCCACTTGCTGGAGG - Intergenic
1002552253 5:180003315-180003337 AAGCAGAGAGCAGGTGCTGGTGG + Intronic
1002894366 6:1367714-1367736 AAGGAGACTGCTGTGAGTGGAGG - Intergenic
1003541892 6:7025441-7025463 AGGGTGGGTGCAGAGGCTGGTGG - Intergenic
1003571230 6:7257928-7257950 ATGGAGTGTGCACTGGCTGCCGG - Intergenic
1006298243 6:33179534-33179556 TTGGAGAGTGCTGGGGCTGGGGG - Intronic
1006796926 6:36737828-36737850 CAGGATGGTGCAGAGGCTGGAGG - Intergenic
1007051369 6:38834036-38834058 AAGCAGAAAGCAGTGTCTGGTGG - Intronic
1007153011 6:39713466-39713488 AAGCAAAGGGCAGTGGCTGGAGG + Intronic
1007761001 6:44133739-44133761 AAGGAGGGGGGAGTGGGTGGGGG - Intronic
1008397357 6:51024429-51024451 AAGGGGAGGACAGGGGCTGGAGG - Intergenic
1008752259 6:54749938-54749960 CAGGAGTGTGGAGTTGCTGGAGG + Intergenic
1009310622 6:62147672-62147694 CTGGAAAGTCCAGTGGCTGGAGG + Intronic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1011868547 6:91862379-91862401 GAAGAGAGTCCAGTGGCAGGGGG + Intergenic
1011914631 6:92488457-92488479 AAGGAGAACGCAGTCGCAGGAGG - Intergenic
1015154271 6:130074547-130074569 AAGGAGGCTGCAGTGGCGGGAGG - Intronic
1015162378 6:130168025-130168047 AAAGAGAATGCAGTGGGTGGAGG + Intronic
1015569295 6:134604724-134604746 AGGGACAGAGCAGTGGCAGGTGG - Intergenic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016086684 6:139923444-139923466 AGGGAGATAGCAGTGGCTGCAGG - Intergenic
1017751245 6:157492208-157492230 AGGGAGACTACAGTGGCTGGGGG - Intronic
1018915209 6:168128716-168128738 AATGTGAGTGCAGAGGCTGCTGG + Intergenic
1018997798 6:168723737-168723759 AAGGTGAGTGGAGGGGCTGAGGG - Intergenic
1019013353 6:168861001-168861023 CTGGAGAGTGCAGAAGCTGGTGG - Intergenic
1019144679 6:169969116-169969138 AGGGAGAGTGGAGTCTCTGGAGG + Intergenic
1022310153 7:29189683-29189705 AAGGGGAGTGTAGGGGGTGGGGG - Intronic
1022355019 7:29606557-29606579 AGAGAGAGGGCAGTGGATGGAGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1026128888 7:67604215-67604237 AAGCTGAGTGCAGTGGTTTGAGG + Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028242488 7:88438160-88438182 AAGGAGTGGGCAGTGGTTGAGGG - Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029405318 7:100371471-100371493 AAGGAGAGGTGAGGGGCTGGGGG + Intronic
1029538325 7:101168786-101168808 AAAGAGAGAGCAGGGGCTTGTGG + Intergenic
1029630369 7:101746459-101746481 AAGGAGGAGGCACTGGCTGGGGG - Intergenic
1030319701 7:108152395-108152417 AAGGAGCTTGGTGTGGCTGGGGG + Intronic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1033450528 7:141458580-141458602 AAGGAGAATGGAGTGGGTGATGG + Intronic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033599046 7:142876114-142876136 AAGGAGAGACGAGAGGCTGGAGG + Intronic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1034853109 7:154514552-154514574 ATGGTGGGTGCAGGGGCTGGGGG - Intronic
1035020381 7:155797177-155797199 CTGGAGAGAGCGGTGGCTGGAGG - Intergenic
1035607115 8:937092-937114 AAGAAGAGTGCCATGGCTGAAGG - Intergenic
1035635779 8:1143115-1143137 AAGGAGAGAACCCTGGCTGGAGG - Intergenic
1035756581 8:2037272-2037294 AAAGAGAGAGCAGCAGCTGGAGG + Intergenic
1035817287 8:2554821-2554843 AAGCAGAGTGCACTGTTTGGAGG + Intergenic
1036571027 8:9979984-9980006 AGGGAGGAGGCAGTGGCTGGAGG + Intergenic
1036617469 8:10399717-10399739 TAGGAGGGTGCAATGGATGGTGG + Intronic
1036746801 8:11415560-11415582 GCCGAGAGTGCAGTGGGTGGGGG + Intronic
1037159612 8:15752212-15752234 AAGGAGAGAGGAGGGGCTGAGGG + Intronic
1037475253 8:19250959-19250981 AAGGAGAGTAAAGTTGATGGAGG - Intergenic
1039727054 8:40229736-40229758 AAGCAGAGGGCAGTGGGGGGAGG - Intergenic
1039979246 8:42392256-42392278 AAGGAGGGGGCAGGGGCGGGCGG - Intronic
1040703233 8:50092954-50092976 AAGGAAAGCACTGTGGCTGGTGG + Intronic
1041143664 8:54848250-54848272 GAGGAGAGTGCAGAAGCAGGTGG - Intergenic
1041289090 8:56291347-56291369 AAGGACAGTGCAGGGAGTGGTGG + Intergenic
1041764543 8:61404674-61404696 AAAGAGAGGGAAATGGCTGGTGG + Intronic
1042338848 8:67657834-67657856 AGGGAGAGTGCACTGGCATGAGG - Intronic
1042771298 8:72385615-72385637 AATGAGCCTGCAGTGCCTGGTGG - Intergenic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043423987 8:80130528-80130550 AAGAAGAGTGCTCTGGGTGGAGG - Intronic
1044344752 8:91092222-91092244 AAGAAGTGAGCAGTGGCTGGAGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044826634 8:96204512-96204534 AAGCAGAGGTCAGTGGCTTGTGG - Intergenic
1045325776 8:101116656-101116678 AAGTAGAGGGCTGAGGCTGGAGG + Intergenic
1045347871 8:101310879-101310901 GGGGAGAGTGAAGAGGCTGGAGG - Intergenic
1045497726 8:102722341-102722363 AAGGAGTGGACAGTGGATGGAGG - Intergenic
1047715119 8:127588231-127588253 AAGGAGGTTGCTTTGGCTGGAGG + Intergenic
1048308034 8:133297154-133297176 AAGGACGGTGCCGAGGCTGGCGG + Exonic
1048995422 8:139791044-139791066 AAGGAGGGTGAATTGGCTCGTGG - Intronic
1049299741 8:141863173-141863195 AAGGAGAGAGCAGCCGCCGGGGG + Intergenic
1049322674 8:142005309-142005331 AAGGAGAGTGAGGCTGCTGGGGG + Intergenic
1049538497 8:143194332-143194354 GAGGCCAGTGCAGGGGCTGGGGG + Intergenic
1049538580 8:143194627-143194649 AAGACCAGTGCAGGGGCTGGGGG + Intergenic
1049538619 8:143194768-143194790 AGGGCCAGTGCAGGGGCTGGTGG + Intergenic
1049557388 8:143289736-143289758 GAGGAGAGGGCAGTGGCTTCTGG + Intronic
1049580115 8:143407267-143407289 AAGGAGAGCTCAGTGGCTGGTGG + Intergenic
1049643056 8:143724032-143724054 ATGGAGAGGCCAGAGGCTGGCGG - Exonic
1049718822 8:144106267-144106289 AAGGACAGTGGGGTGGCTGTGGG - Intronic
1049858887 8:144883659-144883681 GTGGAGAATGCAGTGGCAGGAGG + Intronic
1049986340 9:955140-955162 AAGGAGAGTACTGTGGCCTGAGG + Intronic
1050085226 9:1958382-1958404 AAGAAGACTGCAGTGTCTGATGG - Intergenic
1050191057 9:3026846-3026868 AAAGATAGAGCAGTGGCAGGAGG - Intergenic
1050248062 9:3713005-3713027 TGGAAGAGTGCAGTGACTGGGGG + Intergenic
1050588754 9:7140968-7140990 AAGGCAAGTGCAGCTGCTGGAGG + Intergenic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052319700 9:27154746-27154768 AAGGACAGAGTACTGGCTGGTGG + Intronic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1057549301 9:96040214-96040236 AGGAAGAGTGCAGAGGCTGGCGG - Intergenic
1057720475 9:97528024-97528046 AAACAGAATGCAGTTGCTGGTGG - Intronic
1057937950 9:99256615-99256637 GAGGAGAGTGGAGGGGCAGGAGG + Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058915070 9:109557648-109557670 AAGGAGAGGGCAGTGAGTCGAGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1060060756 9:120457310-120457332 AGGGAGAGTGCAGTGGGCTGTGG - Intronic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1060520120 9:124289581-124289603 AGGCAGTGTGCAGGGGCTGGAGG + Intronic
1060998876 9:127891028-127891050 ACCGAGAGGGCAGTGTCTGGTGG + Exonic
1061059545 9:128243595-128243617 ATGGAGTGTGCAGTGGCATGGGG + Intronic
1061275746 9:129568756-129568778 AAGGAGAGGGCAGCGGGCGGGGG + Intergenic
1061682713 9:132250852-132250874 AAGGAGTGTGCAGGCTCTGGGGG + Intergenic
1062097288 9:134709938-134709960 TGGGAGGGTCCAGTGGCTGGGGG + Intronic
1062221637 9:135419251-135419273 AGGGAGAGGGCAGTGGTGGGTGG - Intergenic
1062382584 9:136294618-136294640 GAGGAGGGTGCCGTGTCTGGGGG - Intronic
1062518417 9:136947353-136947375 GCAGAGAGTGCAGTGGCTGTGGG - Intronic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1185498778 X:582237-582259 AAGGCCAGTGCAGTGGCTCAAGG + Intergenic
1185755848 X:2652309-2652331 AAGGAGACTACAGTGTTTGGGGG + Intergenic
1186305508 X:8252350-8252372 AAGGATAGAGCAGAGGCTGTGGG + Intergenic
1186369034 X:8927717-8927739 AGGGAGACAGCAGTGGCGGGAGG - Intergenic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1186927465 X:14350897-14350919 AAGGATAGCGGAGGGGCTGGTGG + Intergenic
1187362947 X:18644964-18644986 AAGCAGAGGGCAGGGGCTGGTGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188539447 X:31233193-31233215 CAGGAGAGAGCAGTGACTGAAGG - Intronic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1188945926 X:36301687-36301709 AAGCAGAGTTCAGGGGCTGGTGG + Intronic
1188974775 X:36659978-36660000 AAGGAGAGCACAGAGACTGGGGG + Intergenic
1190329655 X:49227982-49228004 AAGAAGTGGGCAGTGGCTGAGGG + Intronic
1190340168 X:49290138-49290160 AAGCAGAGTGCAGTGGGAAGTGG + Intronic
1190374467 X:49775451-49775473 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1190626534 X:52343260-52343282 AAGCAGAGTGCAGTGGGAAGTGG + Intergenic
1191055093 X:56232839-56232861 AAGGAGAGGGCCGGGGGTGGGGG - Intronic
1192560249 X:72123619-72123641 AAGGAGACCACAGTCGCTGGAGG + Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1195489469 X:105450215-105450237 AGGGCGAGTGCAGTGACTTGGGG - Intronic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196485704 X:116204163-116204185 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197355554 X:125434618-125434640 AAGGACTTTGCACTGGCTGGAGG + Intergenic
1197375882 X:125681738-125681760 AGTGAGAGTGCAATGACTGGAGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197710989 X:129667105-129667127 GAGGAGAGGGGAGGGGCTGGAGG + Intergenic
1198402372 X:136280248-136280270 CAGGTGGGTGCAGTGGGTGGAGG + Intergenic
1198761890 X:140040932-140040954 AAGGAGAGCTCAGTGACTAGGGG - Intergenic
1198770683 X:140126903-140126925 AGGGAGAGTGTAGTGACTAGGGG - Intergenic
1199170140 X:144726029-144726051 AAGGAGTGTGAAGTAGCAGGTGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199393177 X:147305732-147305754 AAGGACAGTGCAGTGACTTGGGG + Intergenic
1199431839 X:147770667-147770689 AGAGAGAGTTCAGTGGCTGTGGG + Intergenic
1199916495 X:152347343-152347365 AAGGATAGTGGAGTGGTTGAGGG + Intronic
1200158897 X:153994342-153994364 GAGGAGAGAGCATTGGGTGGGGG + Intergenic
1200234714 X:154462694-154462716 AAGGAGAGGGCAGGGGCAAGTGG - Intronic