ID: 982687974

View in Genome Browser
Species Human (GRCh38)
Location 4:158514745-158514767
Sequence TGATGGTTATCACAAGTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982687974_982687977 26 Left 982687974 4:158514745-158514767 CCACTGACTTGTGATAACCATCA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 982687977 4:158514794-158514816 TCTGTTGACTTAAGCAACTAAGG 0: 1
1: 0
2: 1
3: 17
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982687974 Original CRISPR TGATGGTTATCACAAGTCAG TGG (reversed) Intronic