ID: 982687974 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:158514745-158514767 |
| Sequence | TGATGGTTATCACAAGTCAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 146 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 9, 4: 136} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 982687974_982687977 | 26 | Left | 982687974 | 4:158514745-158514767 | CCACTGACTTGTGATAACCATCA | 0: 1 1: 0 2: 0 3: 9 4: 136 |
||
| Right | 982687977 | 4:158514794-158514816 | TCTGTTGACTTAAGCAACTAAGG | 0: 1 1: 0 2: 1 3: 17 4: 199 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 982687974 | Original CRISPR | TGATGGTTATCACAAGTCAG TGG (reversed) | Intronic | ||