ID: 982687977

View in Genome Browser
Species Human (GRCh38)
Location 4:158514794-158514816
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 199}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982687973_982687977 29 Left 982687973 4:158514742-158514764 CCTCCACTGACTTGTGATAACCA 0: 1
1: 0
2: 1
3: 17
4: 157
Right 982687977 4:158514794-158514816 TCTGTTGACTTAAGCAACTAAGG 0: 1
1: 0
2: 1
3: 17
4: 199
982687974_982687977 26 Left 982687974 4:158514745-158514767 CCACTGACTTGTGATAACCATCA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 982687977 4:158514794-158514816 TCTGTTGACTTAAGCAACTAAGG 0: 1
1: 0
2: 1
3: 17
4: 199
982687976_982687977 9 Left 982687976 4:158514762-158514784 CCATCATGGTCATGTAAAATGAG 0: 1
1: 0
2: 1
3: 18
4: 182
Right 982687977 4:158514794-158514816 TCTGTTGACTTAAGCAACTAAGG 0: 1
1: 0
2: 1
3: 17
4: 199
982687972_982687977 30 Left 982687972 4:158514741-158514763 CCCTCCACTGACTTGTGATAACC No data
Right 982687977 4:158514794-158514816 TCTGTTGACTTAAGCAACTAAGG 0: 1
1: 0
2: 1
3: 17
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type