ID: 982691926

View in Genome Browser
Species Human (GRCh38)
Location 4:158558216-158558238
Sequence AATGAGGACACCAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 275}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982691926_982691931 29 Left 982691926 4:158558216-158558238 CCTTCCTCATTGGTGTCCTCATT 0: 1
1: 0
2: 1
3: 36
4: 275
Right 982691931 4:158558268-158558290 TTGCAAATGCACACACAGCCGGG 0: 1
1: 0
2: 1
3: 34
4: 259
982691926_982691930 28 Left 982691926 4:158558216-158558238 CCTTCCTCATTGGTGTCCTCATT 0: 1
1: 0
2: 1
3: 36
4: 275
Right 982691930 4:158558267-158558289 TTTGCAAATGCACACACAGCCGG 0: 1
1: 0
2: 2
3: 25
4: 287
982691926_982691929 -3 Left 982691926 4:158558216-158558238 CCTTCCTCATTGGTGTCCTCATT 0: 1
1: 0
2: 1
3: 36
4: 275
Right 982691929 4:158558236-158558258 ATTCTGTGTGCTCTAATGCTTGG 0: 1
1: 0
2: 1
3: 37
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982691926 Original CRISPR AATGAGGACACCAATGAGGA AGG (reversed) Intronic
900252444 1:1678174-1678196 AAGGAGGTCACGAATGAGGTGGG - Intronic
902931677 1:19735879-19735901 AATGATGACAGCAGAGAGGATGG + Intronic
903306762 1:22418374-22418396 AAGGAGGAAACCAGTGATGAAGG - Intergenic
903568046 1:24283806-24283828 AATGAAGACACCAATGTGCCTGG - Intergenic
904095217 1:27971678-27971700 CATGAGGACTCTAATGAAGAGGG + Exonic
904599248 1:31664747-31664769 AAGGAGGACACCAACGTGGAAGG - Intronic
904913866 1:33955462-33955484 AATGAGGAAACTAATTAAGAAGG - Intronic
905778184 1:40684300-40684322 AATGAAGACATCACAGAGGAAGG - Intergenic
906323078 1:44828539-44828561 AACGAGGGCAGCCATGAGGAAGG + Exonic
906937504 1:50226932-50226954 AATGAGGAGGCCAATGTGGCTGG + Intergenic
907393645 1:54174903-54174925 AATGAGGAAACCAAGGCAGAGGG + Intronic
908208723 1:61878227-61878249 ACTGAGGACACTGAGGAGGAAGG - Intronic
908755861 1:67468310-67468332 AGTCAGGACACCAAGGAGCAGGG - Intergenic
909499636 1:76319815-76319837 AAGGATGAAATCAATGAGGAGGG - Intronic
910809913 1:91225625-91225647 ACTGAAGACAGCAAAGAGGAAGG - Intergenic
912574020 1:110647982-110648004 AATGAGAACACCTATGATTATGG - Intergenic
914359732 1:146923305-146923327 AATGAGGAAACCAAGGAATAGGG - Intergenic
914494019 1:148176589-148176611 AATGAGGAAACCAAGGAATAGGG + Intergenic
915466874 1:156103350-156103372 AATGAGGCCGCCAAGGAAGAGGG + Intronic
915479027 1:156172716-156172738 AATGAGGACTGCCATGAGGGAGG + Intronic
915921776 1:159981177-159981199 TATAAGGACACCAATCAGAATGG - Intergenic
916024226 1:160820092-160820114 AATGTGGACTACAATGAGGATGG + Intronic
917607031 1:176642171-176642193 AAAGAGTACATAAATGAGGAAGG + Intronic
918184023 1:182111504-182111526 AATGATGGGACCGATGAGGAGGG + Intergenic
918415592 1:184303618-184303640 AATAAGCACACCAAAGAGAATGG + Intergenic
919340745 1:196303240-196303262 AATGTGAACATCAAGGAGGAAGG + Intronic
919667811 1:200309363-200309385 AATGAGGACAAAAAGGAGGATGG - Intergenic
919818511 1:201457408-201457430 AATGAGGACACTTGTGTGGAAGG + Intergenic
920617457 1:207507503-207507525 AATAAGGACACCAATCATAATGG + Intronic
922113091 1:222581811-222581833 AACAAGGAGACCAGTGAGGATGG + Intronic
923557796 1:235014555-235014577 AAGGGGGAGACCAATTAGGAGGG - Intergenic
924642346 1:245846160-245846182 AATGAGGACAGCATCCAGGAAGG + Intronic
1063726377 10:8641936-8641958 ATTTAGGACATTAATGAGGAAGG + Intergenic
1064328573 10:14373221-14373243 AATGAACACAGAAATGAGGAAGG + Intronic
1065507260 10:26441542-26441564 AATGAGGACTCCAAAGAGGCTGG + Intronic
1065705798 10:28470604-28470626 AATGATGACAGCAATGATGATGG - Intergenic
1067770418 10:49118801-49118823 ATTGGGGTCACCAATGAGGTTGG - Intergenic
1068515750 10:58023283-58023305 AGTCAGGACCCTAATGAGGAAGG - Intergenic
1068633139 10:59318862-59318884 TAGGAGCACACTAATGAGGAAGG + Intronic
1069111152 10:64448029-64448051 AATAATGACACAAATGAGGAAGG + Intergenic
1071973491 10:90931531-90931553 AATGAGGAAACCAGTGAGTGTGG + Intergenic
1073313211 10:102559201-102559223 AAAGGGGACACCAATGAGGGCGG - Intronic
1074288545 10:112120962-112120984 AATGAAGACATCATTTAGGATGG - Intergenic
1074556301 10:114493959-114493981 AAAGAGAACAGCAATAAGGAAGG + Intronic
1075301534 10:121328932-121328954 AATGGGCACACCAATGAGGTGGG + Intergenic
1075601620 10:123773339-123773361 AATGATGACCACAATGAGGGAGG - Intronic
1075728034 10:124620574-124620596 CATGGGGACACCAATGTGGGGGG + Exonic
1076076601 10:127538483-127538505 AATGAAGACATCAATGATGAGGG + Intergenic
1076285349 10:129290204-129290226 AATGAGGACCCTAAGGAGGATGG + Intergenic
1078077073 11:8171918-8171940 TATGAGGACAGAAATGAGGTGGG + Intergenic
1078915268 11:15772924-15772946 AATGAGGAGCCTAAGGAGGAAGG + Intergenic
1079452944 11:20613018-20613040 GATGATGACACAAATGAGGAAGG - Intronic
1079905832 11:26245967-26245989 AATGAAAACTCCAATAAGGAAGG + Intergenic
1080128362 11:28764687-28764709 AATGAGCATACCAATGTGGTTGG + Intergenic
1080161356 11:29180461-29180483 AATGAGGAGAGCAAGAAGGAAGG - Intergenic
1080299062 11:30763959-30763981 AATTAGTACATCAAAGAGGATGG - Intergenic
1080967047 11:37224980-37225002 AATTTGGGCACCAATGAGCATGG - Intergenic
1081586638 11:44389507-44389529 AACGACAACAGCAATGAGGAAGG - Intergenic
1082029575 11:47594514-47594536 AAGGAGGTCACAGATGAGGAAGG - Exonic
1082108488 11:48245654-48245676 AATCAGCAGACCAATGAGGAAGG - Exonic
1083107780 11:60375199-60375221 AATGAAAACACCATAGAGGAAGG + Intronic
1084987349 11:72887336-72887358 ACTGTGGACACGAATGAAGACGG + Intronic
1085997723 11:81941096-81941118 AATGAGGATAATAATGATGATGG + Intergenic
1086026464 11:82298186-82298208 AATGAAGACAGCAATAAGAAAGG + Intergenic
1086342094 11:85857269-85857291 AATGAGGGTCTCAATGAGGATGG - Intronic
1086919760 11:92573127-92573149 TATCAGGACAGCAATGAGAAAGG + Intronic
1089395069 11:118131375-118131397 ACTGAGGTCACCAATGACCAAGG + Intergenic
1089850964 11:121496111-121496133 AGAGAGGACAGCACTGAGGAAGG + Intronic
1090801584 11:130176179-130176201 CCTCAGGACACCAGTGAGGACGG - Intronic
1091174753 11:133547917-133547939 AATCAAGACATCAAGGAGGAAGG - Intergenic
1092908885 12:13127772-13127794 AATGAGGACCCAAGTGAGCAGGG + Intronic
1096224275 12:49855014-49855036 AAAGAGGACACCCATGAGCTGGG - Intergenic
1097543159 12:60965178-60965200 AATGTGGACACCAATGGAAATGG + Intergenic
1098158580 12:67625190-67625212 AATGAGGAGACCAAAGAGACTGG - Intergenic
1099407013 12:82276549-82276571 AATGTGGACAGCAATAAGGTGGG - Intronic
1101135840 12:101742209-101742231 AATGAGGCCAAGAATGAGGCTGG + Intronic
1103832470 12:123790749-123790771 AAAGAGGACAGGAGTGAGGAAGG + Intronic
1103849500 12:123922795-123922817 TATAAGGACACCAGTGAGGTTGG + Intronic
1104069675 12:125333523-125333545 AATGAGCCCAACACTGAGGAGGG - Intronic
1104326506 12:127803735-127803757 AATGAATACACAAATGAGCATGG + Intergenic
1104662176 12:130619234-130619256 AATGTGGACCTCATTGAGGAAGG - Intronic
1105410273 13:20165993-20166015 AATGAGGACAGCAGGGTGGAGGG + Intergenic
1107447106 13:40479468-40479490 AAAGATGTCCCCAATGAGGAGGG + Intergenic
1107576929 13:41734502-41734524 AATGAGGACTCTGATGGGGAAGG - Intronic
1107726531 13:43305083-43305105 AATGAGGCTACCAATGATGAAGG - Intronic
1109692841 13:65915681-65915703 AATGAGGACACCAATATGGAAGG - Intergenic
1109838323 13:67887881-67887903 AATCAGGACACGAGTGTGGAAGG - Intergenic
1111641160 13:90972352-90972374 AAAGAAGAGACCAATTAGGAGGG + Intergenic
1112259042 13:97861688-97861710 TATGAGGACACCAATCAGTTTGG - Intergenic
1112907500 13:104442970-104442992 TACAAGGAGACCAATGAGGAAGG + Intergenic
1113077244 13:106479251-106479273 ACTGAGGAAAACAATAAGGAGGG + Intergenic
1115038263 14:28887249-28887271 AATGAGGTTACAAATGAGAATGG - Intergenic
1115396795 14:32918031-32918053 AATGAGGACCCCATTGTGGGTGG + Intergenic
1117764338 14:59064820-59064842 AAGGAGGAAAGCAAGGAGGAGGG + Intergenic
1117785047 14:59274838-59274860 AATGGGGACACCAAAGTGGTTGG + Intronic
1119267761 14:73274146-73274168 GATGAGGATAGCAATGGGGAAGG + Exonic
1119730644 14:76948813-76948835 AGTAAGGAGACCAATAAGGAAGG - Intergenic
1120668029 14:87330335-87330357 AATGAGAATAATAATGAGGATGG - Intergenic
1120826717 14:88962724-88962746 CATGAGGACACCAAGGAAGGAGG - Intergenic
1121303421 14:92889920-92889942 AATGAGAACACCCAGAAGGAAGG + Intergenic
1122150584 14:99724101-99724123 TATAAGGACACCAATCAGGTTGG + Intronic
1123982841 15:25619662-25619684 AATTAGTACACCAATGAAGCTGG + Intergenic
1124142936 15:27093313-27093335 GATGGGAAAACCAATGAGGAGGG - Intronic
1125930323 15:43595153-43595175 GATGAGGAGACCTATGAGGTAGG + Exonic
1125943491 15:43694985-43695007 GATGAGGAGACCTATGAGGTAGG + Exonic
1128183605 15:65625612-65625634 AATGAAGACACCGATGAGGGAGG - Exonic
1128659337 15:69486586-69486608 AATGAAGACACCAAGGAACAGGG - Intergenic
1128840595 15:70847913-70847935 ATGGTGGACACCAATAAGGAAGG + Intronic
1129241539 15:74255192-74255214 GATGAGGAGATCAATGAGGAAGG - Intronic
1131600951 15:93848244-93848266 AGTGAAGACAGCAATGGGGAGGG - Intergenic
1131872410 15:96776139-96776161 AATGAGAACACCAGCAAGGAAGG - Intergenic
1132790720 16:1685815-1685837 ACTGAGGACACAAAAGTGGACGG + Exonic
1132929291 16:2450751-2450773 AATGTGGAAACCAGTGAGGGTGG - Intronic
1135578910 16:23608503-23608525 AATGAGGACACACATGTGCAGGG + Intronic
1136072322 16:27795200-27795222 AATGAAGAAACCATGGAGGAAGG + Intronic
1136629463 16:31481053-31481075 AATGGGGAGGCCAAAGAGGAAGG + Intergenic
1138271409 16:55698518-55698540 CATGAGGACAGCAAAAAGGATGG - Exonic
1138963419 16:62054516-62054538 AATGATGAGACCAATGAAGTTGG - Intergenic
1140125009 16:72111498-72111520 CATGGGGACACCAGTAAGGATGG - Intronic
1140422202 16:74829545-74829567 AATAATGACACAAAGGAGGAAGG + Intergenic
1141589412 16:85057917-85057939 GTTGGGGTCACCAATGAGGAGGG - Intronic
1142111050 16:88331842-88331864 AATGATGACAACAATGGTGATGG - Intergenic
1142246043 16:88970511-88970533 GATGAGGACACAAATCAGAAAGG - Intronic
1143490653 17:7283609-7283631 AGAGATGATACCAATGAGGAAGG - Exonic
1144491502 17:15715750-15715772 AATGAGTACACAGATCAGGATGG - Intronic
1144908985 17:18663455-18663477 AATGAGTACACAGATCAGGATGG + Intronic
1145053252 17:19680678-19680700 AAAAAGGACATCAAAGAGGATGG + Intronic
1145911234 17:28544456-28544478 AATGAGGACAAGAATGTGGAAGG - Intronic
1146629920 17:34462564-34462586 AATGAGGCCATGAATGTGGAAGG + Intergenic
1146966460 17:37035385-37035407 AATAAGGACAACAAAAAGGAGGG - Intronic
1147344167 17:39776468-39776490 AGGGAGGACAGCAAGGAGGAGGG + Intronic
1151151788 17:72094735-72094757 GATGATGACAACAATGAAGATGG - Intergenic
1151652817 17:75480707-75480729 AATGAGGACCACACTCAGGAAGG - Intronic
1152222433 17:79075946-79075968 AATAAGGACATCAACGAGGAAGG + Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152323543 17:79622678-79622700 ACTGAGGACACCAGTCAGGTTGG + Intergenic
1153981831 18:10316928-10316950 ACAGAGGACACCCATGGGGACGG + Intergenic
1154145722 18:11864794-11864816 AATGAGGACACCTGAAAGGAAGG + Intronic
1154254115 18:12768004-12768026 CATGAGGACACTGATCAGGAGGG + Intergenic
1155366430 18:25053689-25053711 AATGAAGAGGCCAAAGAGGAAGG + Intergenic
1156082588 18:33356150-33356172 AATGAGGACATCACTGATAATGG - Intronic
1156457407 18:37302510-37302532 CATGAGGACACCTATGAGGGAGG + Intronic
1158679077 18:59550292-59550314 AATGTGGAAACAAATGAGTATGG - Intronic
1158982523 18:62777836-62777858 ATGCAGGACACCAATGAGAAGGG - Intronic
1159813271 18:73042581-73042603 AATGTGGACACACATGAGGCAGG + Intergenic
1160123467 18:76150453-76150475 AAGGAGGAAACCAAGGAGCATGG - Intergenic
1161279149 19:3435625-3435647 AAGAAGGACCCCAATGAGAAGGG - Intronic
1162431519 19:10631682-10631704 AATGAGACGACCTATGAGGATGG + Exonic
1163185953 19:15640035-15640057 AATGAGGGCTCCTAAGAGGAGGG - Intronic
1163848650 19:19651365-19651387 AATGAGGATGACACTGAGGATGG + Intronic
1164410799 19:28003229-28003251 AATGATGCCAGCAATGACGAGGG - Intergenic
1164471259 19:28535613-28535635 AATGAGACCACCAATGAGAAAGG - Intergenic
1164957160 19:32396355-32396377 AATGAGGACACGAATAGGTAAGG - Intergenic
1167204779 19:48093655-48093677 AATGAGAAGACCAGTGAGGCTGG - Intronic
928528762 2:32169275-32169297 ACTCAGGACACCAAGGTGGAAGG - Intronic
928945536 2:36768579-36768601 GATGAGGAAACCAAGGAGTAAGG + Intronic
929246109 2:39705552-39705574 AATGTGGACACCAATGAATAAGG - Intronic
929497028 2:42454061-42454083 AATCAGAACCACAATGAGGATGG + Intronic
930388769 2:50733639-50733661 TATAAGGACACCAATGTGGGTGG + Intronic
931288521 2:60852611-60852633 AAGAAGGAAGCCAATGAGGAAGG + Intergenic
932114321 2:69032437-69032459 AATGAGGGCACCAAGGGAGAGGG - Intronic
932434908 2:71697477-71697499 AATGAGGTCACCGGTCAGGAGGG + Intergenic
935798857 2:106672080-106672102 CATGACAACACCAAGGAGGATGG - Intergenic
940976503 2:159951382-159951404 GTTGAGGACAACAGTGAGGAAGG + Exonic
941110897 2:161417809-161417831 AAAGCGGACACCAATGTGCAAGG + Exonic
941551298 2:166918682-166918704 AAAGAGGACATCAATGGGAAAGG + Intronic
942075822 2:172356334-172356356 GATGAGGCCAACACTGAGGATGG + Intergenic
942136334 2:172929907-172929929 GATGAGGAAACAAATGAGTAAGG - Intronic
943156008 2:184178026-184178048 AATGTGAACATCAATGGGGATGG + Intergenic
943860391 2:192854680-192854702 AATGAGGTTTCCAATGAGGATGG + Intergenic
946064262 2:216973268-216973290 AATGAGCATATCAATGAGGAAGG + Intergenic
946755751 2:222945744-222945766 AATAAAGACACTAATGGGGAAGG - Intergenic
947279088 2:228428224-228428246 ACTGAGGATGCCACTGAGGAGGG - Intergenic
947524986 2:230872247-230872269 TATGTGGACACCACGGAGGAAGG + Intronic
947694222 2:232169988-232170010 AATGGTGACCCCAATCAGGAGGG - Intronic
1168840453 20:906775-906797 AGAGAGGAAAACAATGAGGAAGG - Intronic
1168932384 20:1634566-1634588 GATGAGGTCATAAATGAGGATGG + Intronic
1169842410 20:9954632-9954654 AGGGAGGAAACCAATGAGGCTGG - Intergenic
1170712513 20:18805115-18805137 AATGTGGACACCAATTAAGCAGG + Intergenic
1172787678 20:37479936-37479958 GAAGAGGACACCAAGAAGGAAGG - Intergenic
1173268357 20:41508155-41508177 AAAGAGGACAGCAAAGAGAAAGG + Intronic
1173500210 20:43547894-43547916 AAGGAAGACAGCAATGGGGACGG - Intronic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1176287952 21:5028743-5028765 GATGGGGACACAAATGGGGAGGG - Intronic
1176984132 21:15416691-15416713 AATGAGGGGACCAAAGAGTATGG + Intergenic
1177304106 21:19290159-19290181 AATGAGGAAACTGATGAGGTTGG - Intergenic
1179156384 21:38854644-38854666 AAAGAGAACACCAAGCAGGATGG + Intergenic
1179869229 21:44234732-44234754 GATGGGGACACAAATGGGGAGGG + Intronic
1180910534 22:19447165-19447187 AAGGAGGAGACCAGCGAGGAGGG - Intronic
1181267160 22:21637041-21637063 GATGAGGACAAGGATGAGGATGG + Exonic
1181313538 22:21958122-21958144 AATGAGGACGAGGATGAGGATGG + Intronic
1181346647 22:22224194-22224216 AATGAGGACGAGGATGAGGATGG + Intergenic
1181977211 22:26738473-26738495 AAGGAGGAGAACAAGGAGGAGGG - Intergenic
1182629015 22:31670249-31670271 AATGTGGACATCACTGAGGATGG - Intergenic
1182789441 22:32937616-32937638 AATGAGGACAGCAAGGCGGATGG + Intronic
1183658912 22:39207053-39207075 GAGGAGGACTCCCATGAGGAGGG - Intergenic
1184495337 22:44837881-44837903 ACTGAGGTCCCCAAAGAGGAGGG - Intronic
1184633766 22:45808480-45808502 AAGGAGGACACCAAGGTGGAAGG - Intronic
1184851494 22:47124008-47124030 AAAGAGGACACCATTGACAACGG + Intronic
1185051578 22:48556891-48556913 CATGAGGACACCACTGTGGACGG - Intronic
950210311 3:11118182-11118204 AATGAGGAAACCAAGGATCAAGG + Intergenic
951253320 3:20419231-20419253 AAAGATGACACCAAGGAGGTTGG + Intergenic
952237254 3:31492843-31492865 AGTGAGGACACCAAGGAAGGTGG - Intergenic
952373327 3:32744057-32744079 AATGTGGACACAAATGGTGAAGG + Intronic
955176053 3:56613886-56613908 ACTGAGGAGACCAAGGTGGAAGG - Intronic
956320398 3:67990002-67990024 AATGAGGACACAAATGCACAAGG - Intergenic
957514281 3:81230865-81230887 ACTGAGGAAAACAATGAAGAGGG - Intergenic
957879572 3:86193875-86193897 AATCAGGTCAGCAGTGAGGATGG + Intergenic
959132504 3:102374587-102374609 AATCAGAACAGCAAGGAGGATGG - Intronic
959173088 3:102868103-102868125 AGTGAGGAGACCAATCAGAAAGG - Intergenic
960418706 3:117416425-117416447 AGTGAGGATGCAAATGAGGAGGG - Intergenic
961991878 3:131200818-131200840 AATGAGTACACCAAGGAAGAAGG - Intronic
963704217 3:148665620-148665642 AATGAGAAGACCAAGGAGGGAGG - Intergenic
963809558 3:149762208-149762230 AATGAGGACTCCTAGGATGAGGG - Intronic
964471520 3:157061957-157061979 ACTGAGGACTCCAAAGAGGTTGG + Intergenic
966580583 3:181557952-181557974 AATATGGAAACCAATGAGCATGG + Intergenic
967765550 3:193275394-193275416 AATGAGCACACCTCAGAGGAAGG - Intronic
968838382 4:2981893-2981915 ACTTTGGACACCAATGAGCATGG - Intronic
969717546 4:8875097-8875119 ACTGGGGACACCGGTGAGGAGGG - Intergenic
970604224 4:17664502-17664524 AATGAGGACTCAGATGTGGAAGG - Intronic
970706210 4:18806048-18806070 AATGAGGACACAAATGCATAAGG + Intergenic
971486745 4:27168410-27168432 TATGAGGACACCAGTCAGGTTGG + Intergenic
971628759 4:28961258-28961280 AAAGAGGATTCAAATGAGGAAGG + Intergenic
972699311 4:41478737-41478759 CATGACGTTACCAATGAGGATGG - Intronic
972868112 4:43259506-43259528 AAAGAGGAGAGAAATGAGGATGG - Intergenic
973185718 4:47325522-47325544 AATGAGGAAGATAATGAGGAAGG - Intronic
973939350 4:55890035-55890057 AATTAGGACACCAATGTTAATGG + Intronic
975437099 4:74365409-74365431 AAAGAGGAGACAAATAAGGAAGG + Intronic
976196899 4:82541377-82541399 AATGAGGAGAGCAATGAGCTAGG - Intronic
980029955 4:127815842-127815864 GATGAGGAAACCACTTAGGAAGG + Intronic
982580504 4:157173004-157173026 AATGAGAAAACGAATTAGGAGGG - Intergenic
982691926 4:158558216-158558238 AATGAGGACACCAATGAGGAAGG - Intronic
984881094 4:184410511-184410533 ATTGAGGACGCCATTGAGAAAGG - Intronic
985707325 5:1409054-1409076 GATGAGCACTCCAAAGAGGATGG + Exonic
986182493 5:5406418-5406440 AATGAGGACTCTAAGGAGGGCGG - Intergenic
986650925 5:9962600-9962622 CATGAGGATGCCACTGAGGAGGG - Intergenic
988184146 5:27837688-27837710 AATGAGGATATCAGTGAGGCTGG + Intergenic
988458762 5:31413159-31413181 AAGGAGGAAAGCAGTGAGGATGG + Intronic
990758361 5:59101252-59101274 ACTGAGGAAACCCATGAGAATGG - Intronic
991092180 5:62704257-62704279 ACTTAGGACACTAATGAGAAAGG + Intergenic
993354877 5:86893232-86893254 AATGAGGACAATAATGAAGTGGG + Intergenic
994010043 5:94891558-94891580 AATGAGGCTACCAATGTGAAAGG - Intronic
995022954 5:107386298-107386320 GAAGAGGACACCACAGAGGAAGG + Intronic
995179674 5:109219262-109219284 AATGAGGACAAAAATGACGACGG + Intergenic
995678489 5:114690612-114690634 AATGATTACACTTATGAGGAAGG - Intergenic
995963850 5:117879873-117879895 AAAGAGGAGAGCCATGAGGAAGG - Intergenic
996198577 5:120641314-120641336 ACTGAGGACATTAATGAGGGAGG + Intronic
997736775 5:136218602-136218624 AATGTGCACACCAAACAGGAAGG - Intronic
1001320144 5:170674114-170674136 CAAGAGGAAAGCAATGAGGAAGG + Intronic
1001562048 5:172676292-172676314 GATGAGGCCACCAAAGAAGATGG - Intronic
1001901521 5:175434532-175434554 GATGAGGACGACAAGGAGGAAGG + Intergenic
1002164833 5:177337701-177337723 AATGATGAGACCACTGAGGTAGG - Exonic
1003274580 6:4638435-4638457 TATAAGGACACCAATCAGGTTGG + Intergenic
1003435121 6:6081050-6081072 AAAGAAGACATGAATGAGGAAGG + Intergenic
1004583141 6:16973707-16973729 AATGAGGAAACCAACGTTGAGGG - Intergenic
1004951753 6:20681028-20681050 AATGAAAACACAGATGAGGAAGG + Intronic
1005439844 6:25855184-25855206 AATGAAGCCACCTATGAGGATGG + Exonic
1006557822 6:34883975-34883997 AATCAGTTCACCATTGAGGAAGG + Intronic
1007171728 6:39868896-39868918 ATTGAGGACAGCATTGATGAAGG - Exonic
1007870249 6:45027338-45027360 AATGAGGAAGTAAATGAGGAAGG - Intronic
1009930594 6:70173099-70173121 AATGAGGACAGCTATGAGCAAGG + Intronic
1013188098 6:107779309-107779331 TATGAGAACACCAAGGAGGAGGG + Intronic
1013412173 6:109892104-109892126 GATGCGGACACAGATGAGGAAGG - Intergenic
1014004531 6:116402794-116402816 AATGTTAACACCAATGAAGAAGG + Intronic
1014611036 6:123546689-123546711 AAGGAGGACAGCAATGGGGCAGG - Intronic
1014761175 6:125358348-125358370 AAGGAGGGAACAAATGAGGAAGG - Intergenic
1015152218 6:130052947-130052969 AAAGCTGACACCAAGGAGGATGG + Exonic
1015510057 6:134029549-134029571 AAGGAGGGCTCCAATGACGAGGG + Exonic
1019907386 7:4075056-4075078 GATGAAGACACCACAGAGGATGG + Intronic
1021996265 7:26180750-26180772 AATGAGGAGACAAATGAAGTAGG + Intronic
1022306351 7:29149868-29149890 TATGAGGACACCAATGACATTGG + Intronic
1023855659 7:44182062-44182084 GAAGATGACACCCATGAGGAGGG + Intronic
1024003006 7:45203282-45203304 AATGAGAACAACAAGAAGGAGGG + Intergenic
1024193470 7:47035860-47035882 AATGAAGACATAAATGATGAAGG - Intergenic
1025849692 7:65235870-65235892 AGTGAGGACAGCAATGTGTAGGG + Intergenic
1028334436 7:89634288-89634310 GATGAGAACACAAATGAAGAAGG - Intergenic
1029078305 7:97953007-97953029 TATGAGGTCACCAATGGGGCGGG - Intergenic
1029166434 7:98594776-98594798 GATGTGCACACCAGTGAGGAGGG - Intergenic
1030592150 7:111494762-111494784 AAATAGGACACTAATGATGATGG + Intronic
1031675183 7:124601381-124601403 AACCAGGACACCAATGAACAGGG + Intergenic
1031906710 7:127467937-127467959 ACTGGGGACTCCAAAGAGGAAGG + Intergenic
1032386477 7:131529154-131529176 AATGATGACACCTATTAAGATGG + Intronic
1032430026 7:131853168-131853190 CATCAGGACACCAGGGAGGATGG + Intergenic
1032457505 7:132084640-132084662 AATGATGACACCTATGAGGCAGG + Intergenic
1034496150 7:151423845-151423867 TATGAGGACACCAGTCATGATGG + Intergenic
1035155035 7:156905406-156905428 AATGATGGAAACAATGAGGAAGG + Intergenic
1035384774 7:158463552-158463574 AATGATGATGACAATGAGGATGG - Intronic
1037124302 8:15326866-15326888 AATGATGACACCAAGGATCAAGG - Intergenic
1037177585 8:15965257-15965279 GATGAGGACAATTATGAGGATGG - Intergenic
1039091788 8:33837591-33837613 AATGAGGACATCATTGGCGATGG + Intergenic
1039389426 8:37165473-37165495 AATGAGGACATCAGGGAGTATGG - Intergenic
1040889443 8:52301811-52301833 AATGAGGAAAAAAAGGAGGAAGG - Intronic
1043582263 8:81727732-81727754 AGTGAGGACACCAGTGTGGCTGG + Intronic
1046604134 8:116351888-116351910 AACGAGGCCACCAATCATGAAGG + Intergenic
1046766708 8:118077192-118077214 AAAAAGGTCACCAATGAGCAAGG + Intronic
1046904296 8:119555646-119555668 AATGAAGATATGAATGAGGAAGG - Intergenic
1047748225 8:127861000-127861022 TATCAGTACACCAATGAGGAGGG - Intergenic
1050030981 9:1385183-1385205 AATGAGGCAACCAATGAAAAGGG - Intergenic
1050824573 9:9929933-9929955 AATGAGGACACCAGAGATAATGG + Intronic
1052308808 9:27041569-27041591 AATGAGGAGACCAAGGGAGAGGG - Intronic
1054727798 9:68669181-68669203 AAAGATAGCACCAATGAGGAGGG - Intergenic
1056832335 9:89927393-89927415 ATTGAGAACACCAAACAGGAGGG - Intergenic
1187083918 X:16021933-16021955 CATGGGGAAACCAAGGAGGAGGG + Intergenic
1187235115 X:17459805-17459827 AATGATCACACTATTGAGGAAGG - Intronic
1188132084 X:26448566-26448588 AATGAGGACTATAATGAAGAGGG - Intergenic
1189272858 X:39763878-39763900 ACTGAGGACAACAATGTGGTTGG - Intergenic
1189301607 X:39956400-39956422 GATGGGGACACCAATGATGATGG + Intergenic
1189752269 X:44234440-44234462 ACTTAGCACACCAATGAGTAAGG - Intronic
1190300544 X:49054525-49054547 AATGAGGATAGGAATGAGTATGG - Intronic
1190713783 X:53087787-53087809 GATGAGGACATCTATGAGGAAGG + Exonic
1193928821 X:87526778-87526800 AATGAGGAGACCAAAAAAGAAGG + Intronic
1196100316 X:111840873-111840895 AATGAGGATACCAAGGAAGATGG - Intronic
1199439935 X:147856369-147856391 AATGAGAACAGCAAGAAGGAAGG - Intergenic