ID: 982694462

View in Genome Browser
Species Human (GRCh38)
Location 4:158583662-158583684
Sequence CTGTATTTTCAGAAAAGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1384
Summary {0: 1, 1: 0, 2: 0, 3: 49, 4: 1334}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982694462 Original CRISPR CTGTATTTTCAGAAAAGCCT AGG (reversed) Intronic
900170464 1:1265805-1265827 CTGTATTTTCAGTAGAGACAGGG + Intronic
900683945 1:3935252-3935274 TTGTATTTTTAGTAAAGACTGGG + Intergenic
900758636 1:4455209-4455231 CTGGAGTTTAAGACAAGCCTGGG + Intergenic
901036835 1:6341312-6341334 CTGTATTTTTAGTAAAGACGGGG + Intronic
901377772 1:8851888-8851910 TTGTATTTTTAGTAAAGACTGGG - Intergenic
901390339 1:8941621-8941643 TTGTATTTTCAGAAGAGACGGGG + Intergenic
901606815 1:10465563-10465585 CTGTATTTTTAGTAAAGACGGGG + Intronic
901857825 1:12055537-12055559 CTGGTTTCTCAGAAGAGCCTTGG - Intergenic
901920524 1:12533093-12533115 CAGGATTTTGAGAACAGCCTGGG - Intergenic
901947920 1:12718671-12718693 TTGTATTTTCAGTAGAGACTGGG + Intronic
902024513 1:13372676-13372698 TTGTATTTTTAGTAAAGACTGGG - Intergenic
902135736 1:14303416-14303438 TTGTATTTTTAGAAGAGACTGGG + Intergenic
902161682 1:14535491-14535513 TTGTATTTTCAGTAAAGACGGGG - Intergenic
902252250 1:15161754-15161776 TTGTATTTTTAGTAAAGACTGGG - Intronic
902731311 1:18371397-18371419 TTGTATTTTCAGTAGAGCCGAGG - Intronic
902954846 1:19918580-19918602 TTGTATTTTTAGTAAAGACTGGG + Intergenic
903041146 1:20531606-20531628 CAGGATTTTGAGACAAGCCTGGG + Intergenic
903082865 1:20826019-20826041 CTATATTTTCAGCTATGCCTTGG - Intronic
903144983 1:21365802-21365824 CAGGAGTTTCAGAACAGCCTGGG + Intergenic
903391105 1:22964107-22964129 TTGTATTTTTAGTAAAGCCAAGG + Intronic
903852364 1:26315830-26315852 CTGTATTTTCAGTAGAGACAGGG + Intronic
903893413 1:26585903-26585925 TTGTATTTTCAGTAAAGACAGGG + Intergenic
904133699 1:28294619-28294641 CAGGAGTTCCAGAAAAGCCTGGG + Intergenic
904514697 1:31045308-31045330 CTGTATTTTCAGTAGAGACAGGG + Intronic
904525783 1:31132839-31132861 TTGTATTTTCAGTAGAGACTGGG - Intergenic
905072351 1:35238105-35238127 CTGCAGTTTCAGACTAGCCTGGG + Intergenic
905247026 1:36622203-36622225 CTGTCTCTACAGAAAAACCTGGG - Intergenic
905431189 1:37924999-37925021 TTGTATTTTCAGTAAAGACGGGG - Intronic
905434097 1:37945256-37945278 CTGTATTTTTAGTAAAGACAGGG - Intronic
905470756 1:38189966-38189988 TCGTATTTTCAGAAAAGACGGGG - Intergenic
905579587 1:39074058-39074080 TTGTATTTTCAGTAAAGACGGGG - Intergenic
905709507 1:40089113-40089135 TTGTATTTTCAGAAGAGACTGGG - Intronic
905731195 1:40300549-40300571 TTTTATTTACAGAAAGGCCTGGG + Exonic
907413497 1:54298444-54298466 TTGTATTTACTGAAAATCCTGGG - Intronic
907946440 1:59140347-59140369 TTGTATTTTCAGTAAAGACAGGG - Intergenic
908134207 1:61113418-61113440 TTGTATTTTTAGAAGAGACTGGG - Intronic
908362929 1:63387712-63387734 TTGTATTTTTAGAAAAGACGAGG + Intronic
908581209 1:65519320-65519342 TTGTATTTTCAGTAGAGACTGGG + Intronic
908738436 1:67301932-67301954 TTGTATTTTTAGTAGAGCCTCGG - Intergenic
908905754 1:69006973-69006995 CTCAATTTTCTGAAAAGTCTAGG + Intergenic
909024288 1:70464471-70464493 TTGTATTTTTAGTAAAGACTGGG - Intergenic
909237989 1:73177735-73177757 CTGTATTTTCAGTAGAGACAAGG + Intergenic
909962283 1:81861191-81861213 CTGTATTTTTAGTAAAGACGGGG + Intronic
910491512 1:87777652-87777674 TTGTATTTTCAGCAGAGACTGGG + Intergenic
910787020 1:91010422-91010444 TTGTATTTTTAGTAAAGACTGGG + Intronic
910973018 1:92875542-92875564 TTGTATTTTCAGTAAAGACGGGG - Intronic
911267920 1:95764655-95764677 TTGTATTTTCAGTAAAGACAGGG - Intergenic
911611442 1:99962628-99962650 TTGTATTTTTAGTAAAGACTGGG - Intergenic
911742667 1:101404152-101404174 TTGTATTTTTAGTAAAGACTGGG + Intergenic
911773007 1:101771110-101771132 CTGTATTTTCAAGAGAGCATTGG + Intergenic
912027984 1:105203547-105203569 CTGTATTTTCAGTAGAGACAGGG - Intergenic
912089112 1:106048807-106048829 CTGTATTTTCAGTAGAGACGGGG - Intergenic
912097009 1:106158245-106158267 TTGTATTTTCAGTAGAGACTTGG + Intergenic
912205304 1:107501738-107501760 TTGTATTTTCAGTAAAGACGGGG - Intergenic
912338483 1:108886822-108886844 CTGATTTTTCAGAAGAGCCCAGG + Intronic
912422923 1:109558248-109558270 TTGTATTTTCAGAAAAGACGGGG - Intronic
912532385 1:110335581-110335603 CAGTAGTTTGAGATAAGCCTGGG + Intergenic
912675040 1:111671645-111671667 CTGTATTTTCAGTAGAGACAGGG + Intronic
912996177 1:114534560-114534582 TTGTATTTTTAGTAAAGACTGGG - Intergenic
913008162 1:114655654-114655676 TTGTATTTTCAGGAAAGACGGGG + Intronic
913128900 1:115819352-115819374 CTATTTTCGCAGAAAAGCCTGGG + Intergenic
913409219 1:118532600-118532622 CTGTATTTTTAGTAAAGACAGGG + Intergenic
913420974 1:118668640-118668662 CTGTATTTTTAGTAAAGACAGGG - Intergenic
913450006 1:118986876-118986898 CTGTATTTTAACAGAACCCTAGG - Intronic
914046815 1:144100441-144100463 TTGTATTTTCAGTAGAGACTGGG - Intergenic
914131294 1:144860245-144860267 TTGTATTTTCAGTAGAGACTGGG + Intergenic
914241025 1:145853235-145853257 TTGTATTTTTAGTAAAGACTGGG - Intronic
914383120 1:147138516-147138538 CTGGATTTTGAGACCAGCCTGGG + Intergenic
914417333 1:147496115-147496137 CCGTATTTTCTGAAAGACCTTGG - Intergenic
914698617 1:150109201-150109223 TTGTATTTTTAGTAGAGCCTGGG + Intronic
914805839 1:150990968-150990990 CTGTATTTTCAGTAGAGACAGGG - Intronic
914848908 1:151299515-151299537 CTGTATTTTTAGTAAAGACGAGG - Intronic
914925770 1:151885289-151885311 CTGTATTTTTAGTAAAGTCAGGG + Intronic
915156275 1:153879111-153879133 TTGTATTTTCAGTAAAGACAGGG + Intronic
915180939 1:154059124-154059146 CTGGAGTTTGAGACAAGCCTGGG + Intronic
915198828 1:154211175-154211197 TTGTATTTTCAGTAAAGACGAGG + Intronic
915652941 1:157332529-157332551 CAGTAGTTTGAGAACAGCCTGGG + Intergenic
915655034 1:157352369-157352391 CAGGATTTTGAGAACAGCCTGGG - Intergenic
915819266 1:159004530-159004552 CTGTATTTTCAGTAAAGACAAGG - Intronic
916044489 1:160989189-160989211 TTGTATTTTCAGTAGAGACTGGG + Intergenic
916204968 1:162307627-162307649 CTGTATTTTTAGTAGAGGCTGGG - Intronic
916593504 1:166217911-166217933 TTGTATTTTCAGTAAAGACGAGG + Intergenic
916700229 1:167285416-167285438 TTGTATTTTCAGTAGAGACTGGG - Intronic
916818321 1:168374391-168374413 CTGTGTTTGGAGAAAATCCTGGG + Intergenic
916873562 1:168943489-168943511 CTGTATTTTAACAAGTGCCTAGG - Intergenic
916937417 1:169643979-169644001 TTGTATTTTCAGTAAAGACAAGG - Intergenic
917436273 1:175024248-175024270 TTGTATTTTCAGTAGAGACTGGG - Intergenic
917812779 1:178676069-178676091 TTGTATTTTCAGTAAAGACCGGG - Intergenic
918010325 1:180580780-180580802 TTGTATTTTCAGTAAAGACGGGG - Intergenic
918268155 1:182867573-182867595 TTGTATTTTCAGTAAAGACTGGG + Intronic
918610985 1:186491606-186491628 TTGTATTTTTAGTAAAGACTGGG - Intergenic
918962528 1:191298531-191298553 TTGTATTTTTAGTAAAGACTGGG - Intergenic
919128583 1:193426619-193426641 TTGTATTTTCAGTAGAGACTGGG + Intergenic
919650152 1:200140856-200140878 TTGTATTTTTAGTAAAGACTGGG - Intronic
919666261 1:200295767-200295789 TTGTATTTTTAGAAGAGACTGGG + Intergenic
919992397 1:202717606-202717628 TTGTATTTTCAGTAAAGACAGGG + Intergenic
920569319 1:207004621-207004643 TTGTATTTTCAGTAGAGACTGGG + Intergenic
920746374 1:208632810-208632832 TTGTATTTTCAGTAAAGACGGGG + Intergenic
921667091 1:217885815-217885837 CTGCATTTTCACAAGATCCTTGG + Intergenic
922241666 1:223759449-223759471 CTTTCTTTTCAGAAAAGACCCGG - Exonic
922624491 1:227024773-227024795 CTGTATTTTAAGAAAAGCAAAGG + Intronic
922657055 1:227394468-227394490 CTGTATTTTCAGTACAGACAGGG - Intergenic
922711397 1:227836027-227836049 CAGGAGTTTGAGAAAAGCCTGGG + Intronic
923684864 1:236146979-236147001 CTGTATTTTCAGTAGAGACAGGG + Intronic
923881291 1:238106802-238106824 CTGTAGTTTAAAAAAAACCTTGG - Intergenic
923925378 1:238621166-238621188 ATGTATTTTCAGAACTTCCTGGG + Intergenic
923999689 1:239536737-239536759 CTGTATTTCCAGGAAAACCAAGG + Intronic
924107381 1:240662737-240662759 TTGTATTTTCAGTAAAGACGGGG - Intergenic
924516710 1:244772076-244772098 TTGTATTTTCAGTAGAGACTAGG - Intergenic
924521409 1:244809423-244809445 CTGTATTTTTAGTAAAGACGGGG + Intergenic
924758001 1:246959075-246959097 CAGGAGTTTCAGACAAGCCTGGG + Intronic
1063138042 10:3234109-3234131 CTGTATTTTTAGTAGAGACTAGG + Intergenic
1063152495 10:3349873-3349895 CTGTATTTTTAGTAAAGACAGGG - Intergenic
1063187466 10:3664146-3664168 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1063463120 10:6226911-6226933 CTGTATTTTTAGTAAAGACAGGG - Intronic
1063484885 10:6410573-6410595 CTGGGTTTTCAAAATAGCCTGGG + Intergenic
1063495923 10:6508019-6508041 TTGTATTTTTAGGAAAGTCTTGG + Intronic
1063529491 10:6817618-6817640 TTGTATTTTCAGTAGAGACTGGG + Intergenic
1063827996 10:9920498-9920520 CTGTGTTGTCAGAAAAGCCAAGG - Intergenic
1063869555 10:10403014-10403036 TTGTATTTTTAGAAGAGACTGGG + Intergenic
1063878503 10:10506835-10506857 TTGTATTTTCAGTAAAGACGGGG + Intergenic
1064130337 10:12703694-12703716 TTGTATTTTCAGTAAAGACGGGG - Intronic
1064249936 10:13699247-13699269 TTGTATTTTTAGTAAAGACTGGG + Intronic
1064551046 10:16501101-16501123 TTGTATTTTTAGTAAAGCCAGGG + Intronic
1064840962 10:19591668-19591690 TTGTATTTTTAGAAAAGACAGGG + Intronic
1064920160 10:20507973-20507995 CAGGAGTTTCAGATAAGCCTAGG + Intergenic
1065441144 10:25754889-25754911 TTGTATTTTTAGTAAAGACTGGG + Intergenic
1065532883 10:26690170-26690192 TTGTATTTTCAGTAGAGACTGGG - Intergenic
1065700109 10:28416577-28416599 TTGTATTTTTAGTAAAGCCAGGG + Intergenic
1065873942 10:29981057-29981079 TTGTATTTTCAGTAAAGACGGGG - Intergenic
1065930579 10:30475415-30475437 CTGTATTTTTAGTAAAGACAGGG - Intergenic
1066087477 10:31985098-31985120 CAGTAATTTCAGACCAGCCTGGG + Intergenic
1066110375 10:32190225-32190247 TTGTATTTTCAGTAGAGCCAGGG - Intergenic
1066560446 10:36664221-36664243 TTGTATTTTCAGTAGAGACTGGG - Intergenic
1067117637 10:43447412-43447434 CTGTATTTTTAGTAAAGACGGGG + Intronic
1067858721 10:49821550-49821572 CTGTATTTTTAGTAAAGACACGG + Intronic
1067947020 10:50696092-50696114 TTGTATTTTCAGTAAAGACGGGG - Intergenic
1068018623 10:51550500-51550522 CCTTATTTTCATAAATGCCTGGG + Intronic
1068095248 10:52483410-52483432 CTGCATTTTAACAAAACCCTAGG - Intergenic
1068149169 10:53111093-53111115 TTGTATTTTTAGTAAAGACTAGG - Intergenic
1068579320 10:58721170-58721192 ATGTCTTTTCAGAACATCCTAGG + Intronic
1068930137 10:62581325-62581347 CTGTCTTTTCACAGAAGTCTTGG - Intronic
1068982741 10:63078617-63078639 TTGTATTTTTAGCAAAGACTGGG + Intergenic
1069011495 10:63378415-63378437 TTGTATTTTCAGTAGAGACTGGG - Intronic
1069197061 10:65564191-65564213 CTGTATTTTAAGATAAGTATTGG - Intergenic
1069210044 10:65745408-65745430 CAGGAGTTTCAGAACAGCCTAGG + Intergenic
1069400663 10:68042179-68042201 TTGTATTTTTAGAAAAGACAGGG + Intronic
1069418977 10:68229359-68229381 GTGTATTTTCAGAAACCCCTTGG - Intergenic
1069444462 10:68460279-68460301 CTGTATTTTCAGTAGAGATTGGG + Intronic
1069976176 10:72215224-72215246 CTGTATTTTCAGTAGAGACGGGG - Intronic
1070073128 10:73108927-73108949 TTGTATTTTTAGTAAAGCCAGGG - Intergenic
1070088810 10:73263303-73263325 CTGGAATTTAAGAACAGCCTGGG - Intronic
1070176906 10:73978418-73978440 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1070323973 10:75375687-75375709 TTGTATTTTCAGTAGAGACTGGG + Intergenic
1070882330 10:79861085-79861107 TTGTATTTTCAGTAAAGACGGGG - Intergenic
1070911157 10:80119490-80119512 CTGTATTTTTAGTAAAGACAGGG - Intergenic
1070941677 10:80353939-80353961 TTGTATTTTCAGTAGAGACTGGG - Intronic
1071172537 10:82883719-82883741 CACTATTTTCAGAAAAGCTTCGG + Intronic
1071320049 10:84445648-84445670 CTATATTTTCAGAAATCCATTGG - Intronic
1071510101 10:86256005-86256027 CTGTATTTTAAGGAAAGGCAAGG - Intronic
1071641698 10:87315033-87315055 CTGTGTGTTGAGAAAAGCATGGG - Intergenic
1071648901 10:87377396-87377418 TTGTATTTTCAGTAAAGACGGGG - Intergenic
1071826493 10:89330878-89330900 CTGTGTTTTCACAAGTGCCTTGG - Intronic
1072021050 10:91402035-91402057 TTGTATTTTTAGTAAAGACTAGG - Intergenic
1072109499 10:92305231-92305253 TTGTATTTTCAGAAGAGACGGGG - Intronic
1072261814 10:93683521-93683543 CTGTATTTTCAGTAGAGACAGGG + Intronic
1072386079 10:94929540-94929562 TTGTATTTTCAGAAGAGACAGGG + Intergenic
1072620106 10:97074096-97074118 CTGTATTTTATTACAAGCCTGGG - Intronic
1072959016 10:99912827-99912849 CTGTGTCTTCAGAAATACCTTGG - Intronic
1072985851 10:100139582-100139604 TTGTATTTTTAGTAGAGCCTGGG + Intergenic
1073017745 10:100415308-100415330 TTGTATTTTCAGTAGAGCCGGGG - Intergenic
1073090573 10:100935219-100935241 TTGTATTTTTAGTAAAGACTGGG - Intronic
1073103666 10:101020276-101020298 TTGTATTTTTAGTAAAGACTGGG + Intronic
1073172185 10:101519821-101519843 CTGTATTTTTAGTAAAGACGGGG - Intronic
1074052123 10:109889373-109889395 CTGTATTTTTAGTAAAGACGGGG + Intronic
1074073554 10:110098801-110098823 TTGTATTTTCAGTAAAGGCGGGG + Intronic
1074374175 10:112925434-112925456 CAGAAGTTTCAGACAAGCCTGGG + Intergenic
1074534405 10:114318564-114318586 TTGTATTTTTAGAAAAGACAGGG - Intronic
1074552519 10:114457897-114457919 CTGTATTTTTAGAAGAGACAGGG - Intronic
1074896152 10:117779245-117779267 TTGTGTTTTGAGAAGAGCCTGGG + Intergenic
1075012900 10:118890056-118890078 CAGTAGTTTGAGAATAGCCTGGG - Intergenic
1075300286 10:121316234-121316256 TCCTATTTTCAGAAAACCCTTGG - Intergenic
1075431374 10:122384779-122384801 CTGTATTTTCAGTAGAGACAGGG - Intronic
1075478006 10:122753314-122753336 TTGTATTTTTAGTAAAGACTGGG + Intergenic
1076893219 10:133295272-133295294 CTGTATTTTCAGTAGAGACGGGG - Intronic
1077493598 11:2874048-2874070 CAGGATTTTCAGACCAGCCTGGG - Intergenic
1077755464 11:5024092-5024114 CTGATTTTTCAGGAAAGCCTGGG - Intergenic
1077765357 11:5153539-5153561 TTGAATTTTCTGAAAAACCTGGG + Intronic
1078124913 11:8551841-8551863 CTGCATTTTCCACAAAGCCTAGG - Intronic
1078297416 11:10087809-10087831 CAGCATTTTCAGTAAAACCTGGG + Intronic
1078390109 11:10930021-10930043 TTGTATTTTTAGTAAAGACTGGG + Intergenic
1078419093 11:11193178-11193200 CAGTAGTTTGAGAACAGCCTGGG + Intergenic
1078502245 11:11892117-11892139 TTGTATTTTCATAAAATCATAGG + Intronic
1080005195 11:27399080-27399102 CTGTATTTTCAGTAGAGACTGGG + Intronic
1080029334 11:27644511-27644533 CTGAAGTTTGAGAACAGCCTGGG - Intergenic
1080217729 11:29864847-29864869 CAGGAGTTTCAGACAAGCCTGGG - Intergenic
1080361034 11:31514284-31514306 TTGTATTTTCTGAAGAGCCAGGG - Intronic
1080361792 11:31523079-31523101 CTGAAGTTTAAGAACAGCCTGGG - Intronic
1080494995 11:32808464-32808486 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1080505225 11:32906248-32906270 TTGTATTTTCAGTAAAGACAGGG - Intronic
1080615773 11:33943576-33943598 TTGTATTTTCAGTAAAGACAAGG + Intergenic
1080691477 11:34562400-34562422 ATGAATATCCAGAAAAGCCTTGG - Intergenic
1080844405 11:36014363-36014385 CAGCATTTTCATTAAAGCCTAGG - Intronic
1081273709 11:41120614-41120636 CTGTAGCTTCAGAAAAGACTAGG - Intronic
1081583913 11:44371191-44371213 CAGTATTATGAGAACAGCCTGGG - Intergenic
1081612855 11:44573502-44573524 CTGTGTGTTCAGAAAGGCCAGGG - Intronic
1081615278 11:44587197-44587219 CCGTATTTTCCCACAAGCCTTGG - Intronic
1081700934 11:45152237-45152259 TTGTATTTTCAGTAGAGACTGGG + Intronic
1081890122 11:46534318-46534340 CTGTATTTTTAGTAAAGACGGGG - Intronic
1082069864 11:47930463-47930485 CTGTATTTTCAGTAGAGACAGGG + Intergenic
1082883618 11:58061848-58061870 CTGTAGCTTCAGAAATGTCTCGG + Intronic
1082921988 11:58505507-58505529 CTGCATTTGGAGAAGAGCCTGGG - Intergenic
1083020541 11:59502595-59502617 TTGTATTTTCAGTAAAGACAGGG - Intergenic
1083022253 11:59519142-59519164 CAGGAGTTTCAGAACAGCCTGGG + Intergenic
1083029271 11:59577119-59577141 CTGTTTTTGTAGAACAGCCTTGG - Intronic
1083067108 11:59936177-59936199 ATGTCTTTTCAGAAGAGTCTTGG - Intergenic
1083148256 11:60774201-60774223 CTGGAGTTTGAGACAAGCCTGGG + Intronic
1083411415 11:62495556-62495578 TTGTATTTTTAGAAGAGACTGGG - Intronic
1083450944 11:62744738-62744760 CTGTATTTTCAGTACAGTCAGGG - Intergenic
1083551171 11:63591171-63591193 CAGGAGTTTCAGACAAGCCTGGG + Intronic
1084026717 11:66455118-66455140 CTGTATTTTCAACAAAGCTCTGG + Intronic
1084046671 11:66572709-66572731 TTGTATTTTCAGTAAAGACAGGG + Intergenic
1084129995 11:67126072-67126094 TTGTATTTTCAGTAAAGACGGGG - Intronic
1084253166 11:67918504-67918526 TTGTATTTTCAGTAGAGACTCGG + Intergenic
1084325738 11:68398943-68398965 ATGGAGTTCCAGAAAAGCCTGGG - Intronic
1084522989 11:69675748-69675770 TTGTATTTTCAGTAAAGACGAGG - Intergenic
1084537591 11:69766660-69766682 TTGTATTTTTAGTAAAGACTAGG - Intergenic
1084541010 11:69787210-69787232 TTGTATTTTCAATAAAGACTGGG - Intergenic
1084819715 11:71677422-71677444 TTGTATTTTCAGTAGAGACTCGG - Intergenic
1086099829 11:83087570-83087592 ATGTTTTTTCAGCACAGCCTTGG + Intergenic
1086797010 11:91118056-91118078 CTGTATTTTCAGAACAGATAAGG - Intergenic
1087066645 11:94033654-94033676 CTCTATTTGCTGAAAAGCATAGG - Intronic
1087288096 11:96288367-96288389 TTGTATTTTTAGAAGAGACTGGG - Intronic
1087408918 11:97765973-97765995 CTGTATTTTTAGTAAAGACGGGG + Intergenic
1087959668 11:104332947-104332969 CAGTAGTTTGAGAACAGCCTGGG - Intergenic
1088182487 11:107128073-107128095 GTCTCTTTTCATAAAAGCCTAGG + Intergenic
1088330178 11:108643151-108643173 TTGTATTTTCAGAAGAGGCGAGG - Intergenic
1088478393 11:110267745-110267767 CAGGAGTTTCAGAACAGCCTGGG + Intronic
1088480868 11:110296038-110296060 CTGGATTTTCAAACAACCCTTGG + Intronic
1088485593 11:110337262-110337284 CTGTATTTTCAGTAGAGACGGGG - Intergenic
1088677162 11:112205805-112205827 CAGAAGTTTGAGAAAAGCCTTGG - Intronic
1089230566 11:116971091-116971113 CTGTTTGCCCAGAAAAGCCTTGG + Intronic
1089964358 11:122643573-122643595 CTGTATTTTCAGCAGAGACGGGG - Intergenic
1090801011 11:130172312-130172334 CTGGAGTTTGAGACAAGCCTGGG - Intronic
1090887486 11:130892014-130892036 TTGTATTTTCAGTAAAGACGGGG + Intronic
1090928515 11:131274312-131274334 GTGTGTTTGCAGAAAACCCTGGG - Intergenic
1091454113 12:592526-592548 TTGTATTTTCAGTAAAGACGGGG - Intronic
1092029208 12:5269833-5269855 TTGTATTTTCAGTAAACCCGGGG + Intergenic
1092236011 12:6810060-6810082 TTGTATTTTTAGTAAAGACTGGG + Intronic
1092284465 12:7120851-7120873 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1092400450 12:8171907-8171929 TTGTATTTTCAGTAAAGACGGGG + Intronic
1092549845 12:9486604-9486626 CAGGAGTTTGAGAAAAGCCTGGG - Intergenic
1092656908 12:10695457-10695479 TTGTATTTTTAGTAGAGCCTGGG - Intergenic
1092756871 12:11771760-11771782 CTGCATTCTCAGAAGAGTCTTGG - Intronic
1093191930 12:16084940-16084962 TTGTATTTTCAGTAAAGACGGGG - Intergenic
1093215666 12:16358638-16358660 CTGTATTTTCAGTAGAGGCTGGG + Intronic
1093418252 12:18945491-18945513 CTGTATTTTCAGTAGAGACTGGG + Intergenic
1093454625 12:19352994-19353016 CAGGATTTTCAGACCAGCCTGGG - Intronic
1093469712 12:19487543-19487565 TTGTATTTTTAGAAAAGACAGGG - Intronic
1093479842 12:19593130-19593152 TTGTATTTTCAGTAAAGACGGGG - Intronic
1093729447 12:22550657-22550679 TTGTATTTTCAGTAAAGACAGGG - Intergenic
1093932339 12:24966829-24966851 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1094069617 12:26398248-26398270 TTGTATTTTCAGTAGAGCCGGGG - Intronic
1094202328 12:27806708-27806730 ATATATTTTCAGAAAACCCAAGG - Intergenic
1094643109 12:32295823-32295845 TTGTATTTTCAGTAAAGACAGGG + Intronic
1094681499 12:32671393-32671415 CTGTATTTTCAGTAGAGACAGGG - Intergenic
1095266531 12:40165412-40165434 CTGTATTTTAATAAGAACCTTGG + Intergenic
1095389307 12:41686939-41686961 CTGTATTTTTAGTAGAGACTGGG - Intergenic
1095457917 12:42408918-42408940 CTGTGGTTTCAGAAAACCATTGG - Intronic
1095526949 12:43138097-43138119 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1095581992 12:43810848-43810870 ATGTTTTTTCAGAATAGGCTAGG + Intergenic
1095828797 12:46560486-46560508 TTATTTTTTCAGAAAATCCTAGG - Intergenic
1096090355 12:48895590-48895612 TTGTATTTTTAGTAAAGACTGGG + Intergenic
1096133042 12:49175900-49175922 TTGTATTTTCAGTAAAGACAGGG + Intergenic
1096279466 12:50239785-50239807 CGGGAGTTTGAGAAAAGCCTAGG + Intronic
1096335436 12:50751803-50751825 TTGTATTTTCAGTAGAGACTGGG - Intergenic
1096360706 12:50983663-50983685 TTGTATTTTCAGTAAAGCCAGGG - Intronic
1096817817 12:54212749-54212771 CTGCATTCTCAGAAAGCCCTCGG - Intergenic
1097063751 12:56304952-56304974 CTGTATTTTTAGTAAAGACAGGG - Intronic
1097100313 12:56583479-56583501 CTGTGTTTTTAGTAAAGACTAGG - Intronic
1097122486 12:56745764-56745786 TTGTATTTTTAGTAAAGACTGGG - Intronic
1097229553 12:57501511-57501533 CTGTATTTTCAGTAGAGACAGGG - Intronic
1098012946 12:66073669-66073691 TTGTATTATCAGAAAAGTCAGGG + Intergenic
1098091618 12:66908162-66908184 CTGTATTTTCGGCCAAGACTAGG - Intergenic
1098189750 12:67935527-67935549 TTGTATTTTCAGAAGAGACAGGG - Intergenic
1098277638 12:68829591-68829613 TTGTATTTTCAGTAAAGACATGG - Intronic
1098363414 12:69677570-69677592 CAGTAGTTTGAGATAAGCCTGGG + Intronic
1098404926 12:70114929-70114951 ATGGATCTTCAGCAAAGCCTAGG + Intergenic
1098499521 12:71174620-71174642 CTTTATTTTCACAAAATTCTGGG + Intronic
1098593996 12:72249476-72249498 CTGGAGTTTCAGATCAGCCTGGG + Intronic
1098628005 12:72697091-72697113 CTGTATTTTCAGTAGAGACGGGG + Intergenic
1098846075 12:75537702-75537724 CTGTATTTTTAGTAAAGACGAGG + Intergenic
1099110889 12:78559494-78559516 CTGTAATTTCAGCAAAGAATGGG - Intergenic
1099325992 12:81215084-81215106 CTGTTTTTTCAGAAATGTCCAGG - Intronic
1099677337 12:85778571-85778593 CAGGAGTTTGAGAAAAGCCTGGG - Intergenic
1099756250 12:86853974-86853996 ATTTATCTTCAGAAAAACCTGGG - Intergenic
1099943102 12:89213500-89213522 TTGTATTTTTAGAAAAGACAGGG + Intergenic
1100007903 12:89916332-89916354 CTGTATTTTTAGTAAAGACAGGG + Intergenic
1100070248 12:90707699-90707721 TTGTATTTTTAGAAAAGGCAGGG + Intergenic
1100213721 12:92426188-92426210 TTGTATTTTCAGTAAAGACTGGG - Intronic
1100228786 12:92586351-92586373 CAGGATTTTCAGACCAGCCTGGG + Intergenic
1100301840 12:93314938-93314960 CTGTTTGTTTAGAAAAGCCCGGG - Intergenic
1100422000 12:94444015-94444037 ATGTAATTTCAGAGAAACCTTGG + Intronic
1101010256 12:100442225-100442247 TTGTATTTTCAGTAAAGACGGGG - Intergenic
1101178535 12:102183900-102183922 CTGTATTTTCAGTAGAGACAGGG - Intronic
1101489007 12:105194837-105194859 CTGTATGTTCAGATAAGGCGTGG + Intronic
1101687275 12:107037357-107037379 TTGTATTTTCAGTAAAGACAGGG - Intronic
1101906477 12:108830277-108830299 TTGTATTTTTAGTAAAGACTGGG - Intronic
1101931008 12:109014186-109014208 TTGTATTTTCAGTAGAGACTGGG + Intronic
1102016335 12:109650387-109650409 CAGTAGTTTCAGACAAGCCTGGG + Intergenic
1102103306 12:110298543-110298565 CTGTATTTTCAGTAGAGACAGGG - Intronic
1102136542 12:110580922-110580944 TTGTATTTTTAGTAAAGACTGGG + Intronic
1102291187 12:111701490-111701512 CTGTATTTTCAGTAGAGACAGGG - Intronic
1102294542 12:111726079-111726101 CTGTATTTTCAGTAGAGACGGGG - Intronic
1102335476 12:112075359-112075381 TTGTATTTTCAGTAAAGACAGGG + Intronic
1102480084 12:113216914-113216936 CTGTATTTTTAGTAGAGACTGGG - Intronic
1102627056 12:114243597-114243619 TTGTATTTTCAGTAAAGACAGGG + Intergenic
1103089265 12:118085983-118086005 TTGTATTTTTAGAAAAGACAGGG - Intronic
1103282433 12:119771150-119771172 CTGTATTTTCCGTGATGCCTAGG - Intronic
1103539808 12:121658390-121658412 TTGTATTTTCAGTAAAGACGGGG - Intronic
1103640381 12:122346673-122346695 TTGTATTTTCAGTAAAGACAGGG + Intronic
1103840510 12:123859822-123859844 CAGGATTTTGAGAACAGCCTGGG + Intronic
1103959264 12:124598080-124598102 TTGTATTTTCAGTAGAGACTGGG - Intergenic
1104068283 12:125323689-125323711 CTGTATTTTCAGTAGAGACAGGG + Intronic
1104165318 12:126223311-126223333 TTGTATTTTCAGTAAAGACAGGG + Intergenic
1104316802 12:127710484-127710506 TTGTATTTTCAGTAAAGACAGGG + Intergenic
1104584410 12:130036515-130036537 TTGTATTTTTAGAAAAGACAGGG - Intergenic
1104805455 12:131586646-131586668 CTGTAAGTGCAGAAATGCCTGGG - Intergenic
1105010435 12:132752541-132752563 CTGTATTTTTAGTAAAGACGGGG + Intronic
1105495268 13:20925436-20925458 CTGTATTTTCAGTAGATACTGGG + Intergenic
1105665962 13:22556811-22556833 CTGTATTTTCAGTATAACATTGG - Intergenic
1105742151 13:23337974-23337996 CTATATCTTCATAAAATCCTTGG + Exonic
1105909661 13:24851164-24851186 TTGTATTTTCAGTAAAGACGGGG + Intronic
1106049045 13:26173776-26173798 CTGTATTTTTAGTAGAGCCGGGG - Intronic
1106832980 13:33605028-33605050 CAGGATTTTGAGACAAGCCTGGG + Intergenic
1107099985 13:36579810-36579832 CTGTATTTTCAGTAGAGACGGGG + Intergenic
1107367814 13:39703940-39703962 CAGTAGTTTGAGACAAGCCTGGG - Intronic
1107424156 13:40276129-40276151 CTTTATTTTCTGTAAGGCCTTGG - Intergenic
1107441918 13:40435448-40435470 CTTTACTTTTAGAAAAGGCTGGG - Intergenic
1107473983 13:40717176-40717198 CTGTATTTTTAGTAGAGGCTGGG - Intergenic
1107555628 13:41515137-41515159 TTGTATTTTCAGTAGAGACTGGG + Intergenic
1107697269 13:43012326-43012348 GTGTATTTTCAGTAAAGACAGGG + Intergenic
1107973823 13:45670231-45670253 CTGTAGGTTTAGAAAAGACTTGG + Intergenic
1108040718 13:46337309-46337331 TTGTATTTTTAGTAAAGACTGGG + Intergenic
1108135567 13:47354020-47354042 TTGTATTTTCAGTAAAGACGGGG - Intergenic
1108275219 13:48801673-48801695 CTGTATTATTTGAAAAGCCAAGG + Intergenic
1108364224 13:49693866-49693888 CTGTATTCTCAGAAAACCAAAGG - Intergenic
1109060260 13:57608797-57608819 TTGTATTTTCAGTAAAGACAGGG + Intergenic
1109448876 13:62482806-62482828 CGGTATTTGGAGAAGAGCCTAGG + Intergenic
1109498490 13:63207786-63207808 TTGTATTTTCAGAAGAGACGGGG - Intergenic
1109877145 13:68420372-68420394 TTGTATTTTCAGCAGAGACTGGG + Intergenic
1109957793 13:69591033-69591055 CTGTATTTTTAGAAGAGGCAGGG + Intergenic
1109987505 13:70009338-70009360 CTGTGTTTTAAGAAAACACTAGG + Intronic
1110015767 13:70399868-70399890 CTTAATTTTCAAAAAACCCTTGG + Intergenic
1110250947 13:73379826-73379848 TTGTATTTTTAGTAAAGGCTGGG - Intergenic
1110372192 13:74752277-74752299 AGGTATTATGAGAAAAGCCTGGG - Intergenic
1110461526 13:75750692-75750714 CTGCATTTTAAGAAAATCCCCGG - Intronic
1110591132 13:77260707-77260729 GTTTATTTTCACAAAGGCCTGGG + Intronic
1110907290 13:80907639-80907661 CAGTATTTTAAGATCAGCCTGGG - Intergenic
1111072791 13:83190110-83190132 CTGTTTTATCAGAAAACCTTTGG + Intergenic
1111167749 13:84484415-84484437 TTGTATTTTCAGTAGAGCCGGGG - Intergenic
1111567112 13:90030280-90030302 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1112112537 13:96318357-96318379 TTGTATTTTCAGTAAAGACAGGG - Intronic
1112552212 13:100432023-100432045 TTGTATTTTCAGTAAAGACAGGG - Intronic
1113127756 13:106999271-106999293 TTGTATTTTCAGTAAAGACAGGG + Intergenic
1113369638 13:109711579-109711601 TTGTATTTTCAGTAGAGACTGGG + Intergenic
1113407918 13:110058936-110058958 CTGAATTTTGAGAAATGTCTTGG + Intergenic
1113494725 13:110717653-110717675 CTGTATTTTCAGTAGAGACAGGG - Intronic
1114262702 14:21049947-21049969 TTGTATTTTTAGTAAAGACTGGG + Intronic
1114289214 14:21273747-21273769 TTGTATTTTAAGAAAAGACAGGG - Intergenic
1114610001 14:24033844-24033866 TTGTATTTTCAGTAGAGACTAGG + Intergenic
1114752621 14:25222713-25222735 CTTTATTTTCAGAGAACTCTGGG - Intergenic
1114752666 14:25223124-25223146 TTGTATTTTCAGAAGAGGCAGGG - Intergenic
1115038340 14:28888389-28888411 CAGGATTTTGAGACAAGCCTGGG - Intergenic
1115226486 14:31108260-31108282 CTGTATTTTCAGTAGAGACAGGG + Intronic
1115549026 14:34488520-34488542 TTGTATTTTTAGAAAAGGCGAGG - Intergenic
1115551905 14:34512384-34512406 TTGTATTTTTAGTAAAGACTGGG + Intergenic
1115580377 14:34752098-34752120 TTGTATTTTCAGAATTGTCTTGG + Intergenic
1115606771 14:35010590-35010612 TTGTATTTTCAGTAAAGACGGGG - Intronic
1115637724 14:35306529-35306551 TTGTATTTTCAGTAAAGACAGGG - Intronic
1115684261 14:35778257-35778279 CAGTAGTTTGAGAACAGCCTGGG - Intronic
1115809939 14:37095679-37095701 CTGGAGTTTGAGACAAGCCTGGG + Intronic
1115828400 14:37304663-37304685 CTGTAGTTTCAGAAAAGAAAAGG + Intronic
1115944289 14:38642626-38642648 CTGTATCATGAGAAAAGCATGGG - Intergenic
1116061597 14:39931290-39931312 CAATGTTTTCAGAAAATCCTGGG + Intergenic
1116372647 14:44155115-44155137 CAGTATTTACAGAATGGCCTTGG - Intergenic
1116373973 14:44173618-44173640 CTGTATTTTTAGTAGAGACTGGG + Intergenic
1116440329 14:44943922-44943944 CTGGAGTTTGAGACAAGCCTGGG - Intronic
1116615496 14:47131577-47131599 CTTTATTCCCAGAAAATCCTGGG - Intronic
1116856975 14:49961172-49961194 CTGTATTTTCAGAGAAGGCGGGG + Intergenic
1117053177 14:51882833-51882855 TTGTATTTTTAGTAAAGACTGGG - Intronic
1117146580 14:52842049-52842071 CAGGATTTTCAGACCAGCCTGGG - Intergenic
1117346385 14:54836933-54836955 TTGTATTTTCAGTAGAGACTGGG - Intergenic
1117348284 14:54855639-54855661 TTGTATTTTCAGTAAAGACAGGG - Intronic
1117360825 14:54971976-54971998 CAGTAGTTTCAGACCAGCCTGGG + Intronic
1117501187 14:56353210-56353232 CTGAATCCTCAGAAAAGCCTAGG + Intergenic
1117598653 14:57350737-57350759 CAGGATTTTGAGAACAGCCTAGG + Intergenic
1118201216 14:63675473-63675495 CTGTATTTTTAGTAAAGACAGGG + Intergenic
1118377283 14:65188184-65188206 CTGTATTTTTAGTAAAGACAGGG - Intergenic
1118529727 14:66689676-66689698 TTGTAATTTTAAAAAAGCCTGGG - Intronic
1119230710 14:72977233-72977255 TTGTATTTTCAGTAAAGACAGGG - Intronic
1119285226 14:73447968-73447990 TTGTATTTTTAGTAAAGACTGGG + Intronic
1119374881 14:74182218-74182240 CAGGAGTTTCAGAACAGCCTGGG - Intronic
1119497470 14:75092437-75092459 TTGTATTTTCAGTAAAGACAGGG + Intronic
1119932537 14:78562222-78562244 TTGTATTTTTAGTAAAGACTGGG - Intronic
1120444193 14:84573013-84573035 ATGTATTTTCAGATAAAACTTGG - Intergenic
1120989286 14:90361144-90361166 CAGGAGTTTGAGAAAAGCCTGGG - Intergenic
1121090111 14:91175392-91175414 CTGCATTTTCACAAAAGGCTAGG - Intronic
1121114553 14:91334658-91334680 CTGGATTTTCATATAAACCTGGG + Intronic
1121392525 14:93588564-93588586 CTGTATTTTTAGTAAAGACAGGG - Intronic
1121416390 14:93782091-93782113 CTGTATTTTTAGTAAAGACAGGG - Intronic
1121500356 14:94431086-94431108 TTGTATTTTCAGTAAAGACAGGG + Intergenic
1121506756 14:94483556-94483578 CTGTATTTTTAGTAAAGACGGGG + Intergenic
1121700853 14:95953106-95953128 CTGTTTGTGCAGAGAAGCCTGGG - Intergenic
1121906743 14:97753018-97753040 CTGCATTTCCAGAAACACCTTGG + Intronic
1122548306 14:102537114-102537136 CTGTATTTTTAGTAGAGACTGGG + Intergenic
1122586305 14:102809158-102809180 TTGTATTTTTAGTAAAGACTGGG + Intronic
1123126264 14:105948354-105948376 TTGTATTTTCAGTAAAGACAGGG + Intergenic
1124022808 15:25939524-25939546 CTGCATTTTCACAAGGGCCTTGG + Intergenic
1124083532 15:26523785-26523807 TTGTATTTTTAGTAGAGCCTGGG - Intergenic
1124359690 15:29026737-29026759 CTGTATTTTCAGTAGAGACGGGG - Intronic
1125011232 15:34878210-34878232 CTGTATTTTTAGTAAAGACGGGG - Intronic
1125431484 15:39599095-39599117 CTGTATTTTTAGTAAAGACGGGG + Exonic
1125593173 15:40867990-40868012 TTGTATTTTCAGTAAAGACGAGG + Intergenic
1125821564 15:42636406-42636428 TTGTATTTTTAGTAAAGACTTGG - Intronic
1125830052 15:42709185-42709207 CAGTATTTTGAGATCAGCCTAGG + Intronic
1126060397 15:44775340-44775362 CTTTATAATCAGAAAAGCCGAGG - Intergenic
1126457879 15:48884190-48884212 CTATTTTTTCAGAGAAGCGTGGG - Intronic
1126629986 15:50724400-50724422 TTGTATTTTTAGTAAAGACTGGG - Intronic
1126872840 15:53008246-53008268 TTGTATTTTCAGTAAAGACGGGG - Intergenic
1127144417 15:56009919-56009941 TTAAATTTCCAGAAAAGCCTGGG + Intergenic
1127306725 15:57713234-57713256 TTGGCTTTTCATAAAAGCCTTGG + Intronic
1127442111 15:59019784-59019806 TTGTATTTTCAGTAAAGACAGGG - Intronic
1127555209 15:60081032-60081054 TTGTATTTTTAGAAAAGACAAGG + Intergenic
1127756395 15:62096778-62096800 TTGTATTTTTAGTAAAGACTGGG + Intergenic
1128172371 15:65524123-65524145 TTGTATTTTCAGTAGAGACTGGG - Intergenic
1128425791 15:67541655-67541677 TTGTATTTTCAGTAGAGACTGGG - Intergenic
1128559767 15:68656836-68656858 CTGAATCCTCAGAACAGCCTCGG - Intronic
1128590291 15:68889462-68889484 CTGTATTTTCAGTAGAGACAGGG + Intronic
1128638131 15:69316251-69316273 TTGTATTTTCAGTAGAGCCGGGG + Intronic
1128887248 15:71299912-71299934 CAGGAGTTTCAGAACAGCCTGGG + Intronic
1128888393 15:71309121-71309143 TTGTATTTTCAGTAAAGACAGGG + Intronic
1128915178 15:71553497-71553519 TTGTATTTTCAGGAGAGACTGGG + Intronic
1129086212 15:73095034-73095056 CTGTATTTTCAGTAGAGACGGGG - Intronic
1129416563 15:75386198-75386220 TTGTATTTTCAGAAGAGACGGGG + Intronic
1130020307 15:80224914-80224936 TTGTATTTTCAGTAAAGACCAGG + Intergenic
1130557272 15:84931470-84931492 TTGTATTTTCAGTAAAGACGGGG - Intronic
1130791640 15:87161519-87161541 CAGGAGTTTCAGAACAGCCTGGG + Intergenic
1130950551 15:88583593-88583615 CTGTATTTTCAGTAGAGACAAGG - Intergenic
1131176771 15:90214169-90214191 TTGTATTTTCAGTAAAGTCAGGG - Intronic
1131374278 15:91910790-91910812 CTGTATTTTCAGAGTTCCCTGGG - Intronic
1131756960 15:95575141-95575163 CTGTATTTTTAGAAGAGACGGGG + Intergenic
1132053726 15:98633515-98633537 CAGTAGTTTGAGAATAGCCTGGG + Intergenic
1132555593 16:570636-570658 CTGTATTTTTAGTAGAGACTTGG + Intronic
1132716672 16:1293665-1293687 TTGTATTTTTAGTAAAGCCAGGG - Intergenic
1132952519 16:2571762-2571784 CTGTATTTTCAGTAGAGACAGGG - Intronic
1132961832 16:2628408-2628430 CTGTATTTTCAGTAGAGACAGGG + Intergenic
1133126233 16:3647993-3648015 TTGTATTTTCAGTAAAGACGGGG - Intronic
1133170158 16:3977887-3977909 TTGTATTTTTAGTAAAGACTGGG + Intronic
1133198392 16:4186960-4186982 CTGTATTTTTAGTAGAGACTGGG + Intergenic
1133467361 16:6040766-6040788 TTGTATTTTCAGTAGAGACTGGG + Intronic
1133566472 16:6999897-6999919 CTGTATTTTTAGTAAAGACAGGG - Intronic
1133782097 16:8947518-8947540 TTGTATTTTTAGAAAAGACTGGG + Intronic
1133814756 16:9188203-9188225 TTGTATTTTCAGTACAGACTGGG - Intergenic
1134129351 16:11638526-11638548 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1134265624 16:12690339-12690361 TTGTATTTTCAATAAAGACTGGG - Intronic
1134370144 16:13615810-13615832 TTGTATTTTCAGTAAAGACAGGG + Intergenic
1134601839 16:15539668-15539690 TTGTATTTTTAGTAAAGGCTGGG - Intronic
1135029820 16:19029581-19029603 CAGGAGTTTCAGACAAGCCTGGG - Intronic
1135078742 16:19415970-19415992 CAGTAGTTTGAGACAAGCCTGGG + Intronic
1135326389 16:21528468-21528490 TTGTATTTTTAGAAAAGACAGGG + Intergenic
1135588117 16:23686661-23686683 CTGTATTTTTAGTAAAGACAGGG + Intronic
1136112946 16:28076217-28076239 CTTTGTTTTCAGAGAAGCTTTGG - Intergenic
1136351741 16:29713947-29713969 TTGTATTTTCAGTAAAGACAGGG + Intergenic
1137505458 16:49050409-49050431 CTGTATTTTTAGTAGAGTCTGGG + Intergenic
1137643029 16:50049819-50049841 TTGTATTTTTAGAAAAGACAAGG + Intergenic
1137960589 16:52878140-52878162 TTGTATTTTTAGAAAAGACGAGG + Intergenic
1138395766 16:56703585-56703607 ATGTATTTTCAGCACAGCCACGG + Intronic
1138426424 16:56935960-56935982 CAGGAGTTTGAGAAAAGCCTGGG - Intronic
1138684439 16:58712337-58712359 CTGTATTTTTAGTAGAGACTGGG - Intronic
1138954222 16:61951335-61951357 TTGTATTTTTAGTAAAGACTGGG - Intronic
1138988918 16:62366507-62366529 CTGGAGTTTGAGAAAAGCCTTGG - Intergenic
1139334782 16:66224137-66224159 CAGGATTTTGAGATAAGCCTGGG - Intergenic
1139787735 16:69407493-69407515 TTGTATTTTTAGAAGAGCCAGGG - Intronic
1139829098 16:69782108-69782130 CTGTATTTTTAGTAAAGACAGGG - Intronic
1140185877 16:72771307-72771329 CTGTATTTTCAGTAGAGACGGGG + Intergenic
1140251096 16:73295037-73295059 TTGTATTTTTAGTAAAGACTTGG - Intergenic
1140282804 16:73569993-73570015 CTGTTTTTTAAGGAAAGCTTGGG - Intergenic
1140381068 16:74488331-74488353 CAGTAGTTTGAGAACAGCCTGGG + Intronic
1140518521 16:75562346-75562368 TTGTATTTTCAGTAAAGACGGGG + Intergenic
1140783149 16:78314722-78314744 CTGTATTTTCAGTAGAGACAGGG + Intronic
1141024990 16:80538206-80538228 CGGTAGTTTGAGAACAGCCTGGG - Intergenic
1141111078 16:81271285-81271307 TTGTATTTTTAGAAAAGACGGGG + Intronic
1141303095 16:82836320-82836342 CTGTATTTTTAGTAGAGACTGGG + Intronic
1141646896 16:85372266-85372288 CAGGAGTTTCAGAACAGCCTGGG + Intergenic
1142019609 16:87773180-87773202 TTGTATTTTCAGTAAAGACAAGG + Intergenic
1142277121 16:89125519-89125541 CTGTATTTTCAGTAGAGACAGGG - Intronic
1142437346 16:90069879-90069901 CTGTATTTTCAGTAGAGACAGGG - Intronic
1142534173 17:602242-602264 CTATATTTTAATAAATGCCTGGG - Intronic
1142544433 17:689644-689666 TTGTATTTTTAGTAAAGCCCAGG + Intronic
1143146863 17:4782249-4782271 TTGTATTTTCAGTAAAGACAAGG + Intronic
1143219847 17:5252484-5252506 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1143920672 17:10328848-10328870 TTGTATTTTTAGTAAAGACTGGG + Intronic
1143995076 17:10999243-10999265 TTGTATTTTTAGAAAAGACAGGG - Intergenic
1144200584 17:12937926-12937948 CTGTATTTTTAGAAGAGACAAGG - Intronic
1144216332 17:13058691-13058713 TTGTATTTTCAGTAGAGACTGGG - Intergenic
1144549534 17:16227750-16227772 TTGTATTTTTAGTAAAGACTGGG + Intronic
1145765945 17:27458161-27458183 TTGTTTTTTAAGCAAAGCCTTGG - Intronic
1145818998 17:27816907-27816929 TTGTATTTTTAGTAAAGTCTGGG + Intronic
1145915580 17:28571851-28571873 CTCCATTTTCAGATGAGCCTCGG - Exonic
1145930197 17:28679815-28679837 TTGTATTTTCAGTAAAGACAGGG - Intronic
1146014799 17:29224219-29224241 CTGTATTTTTAGAAGAGACGGGG + Intergenic
1146201494 17:30862611-30862633 CTGTATTTTTAGTAGAGACTGGG + Intronic
1147118382 17:38319926-38319948 CTGTATTTTCAGTAGAGACGGGG - Intronic
1147197349 17:38776140-38776162 TTGTATTTTCAGTAGAGACTGGG + Intronic
1147206852 17:38843596-38843618 TTGTATTTTCAGTAGAGCCGGGG + Intergenic
1147252147 17:39159244-39159266 CAGGAGTTTGAGAAAAGCCTTGG - Intronic
1147507013 17:41028509-41028531 TTGTATTTTTAGTAAAGACTGGG + Intergenic
1147954923 17:44127594-44127616 CTGTATTTTCAGTAGAGACAGGG + Intergenic
1147955174 17:44129336-44129358 TTGTATTTTTAGTAAAGACTGGG + Intergenic
1147982107 17:44281015-44281037 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1148247320 17:46042079-46042101 CTGTATTTTCAGTAGAGACGGGG + Intronic
1148492145 17:48030109-48030131 TTGTATTTTCAGTAAAGACGGGG - Intronic
1148526329 17:48340006-48340028 TTGTATTTTCAGTAAAGACAGGG - Intronic
1148585223 17:48773547-48773569 TTGTATTTTCAGTAGAGTCTGGG - Intronic
1148592775 17:48829203-48829225 TTGTATTTTCAGTAAAGACGGGG - Intergenic
1148619665 17:49025017-49025039 CTGTATTTTCAGTAGAGACAGGG - Intronic
1148650297 17:49245490-49245512 TTGTATTTTCAGTAAAGACGAGG - Intergenic
1148819103 17:50350008-50350030 TTGTATTTTTAGTAAAGACTGGG - Intronic
1148850565 17:50552760-50552782 CAGTAGTTTCAGACCAGCCTGGG - Intronic
1148915145 17:50970339-50970361 CTGTATTTTCAGTAGAGACAAGG - Intronic
1148979168 17:51556566-51556588 TTGTATTTTTAGAAGAGACTCGG - Intergenic
1149174090 17:53848326-53848348 TTGTATTTTCAGTAGAGCCGGGG - Intergenic
1149619336 17:58030831-58030853 TTGTATTTTCAGTAAAGACGGGG - Intergenic
1149673745 17:58439654-58439676 CTGTATTTTCAGTAGAGACGGGG + Intronic
1149778826 17:59380031-59380053 TTGTATTTTCAGTAGAGACTGGG + Intronic
1150252230 17:63712826-63712848 TTGTATTTTTAGAAAAGACGGGG - Intronic
1150276412 17:63900626-63900648 CTGTTTTTGCAGACAAGCCATGG + Intergenic
1150343009 17:64383956-64383978 TTGTATTTTTAGTAAAGGCTAGG - Intronic
1150483217 17:65526632-65526654 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1150756779 17:67921857-67921879 CTGTATTTTTAGAAGAGACAGGG - Intronic
1150800979 17:68282588-68282610 CTGCAGTTTGAGAACAGCCTGGG + Intronic
1150909620 17:69374515-69374537 TTGTATTTTTAGTAAAGACTTGG + Intergenic
1151016119 17:70555076-70555098 ATGAATTTTCAGAAAAATCTAGG - Intergenic
1151385792 17:73754417-73754439 CTGTATTTTTAGTACAGACTGGG - Intergenic
1151469812 17:74311080-74311102 CTGGAGTTTCAGACCAGCCTGGG - Intronic
1151472957 17:74329272-74329294 TTGTATTTTCAGTAGAGACTGGG - Intronic
1151505857 17:74526538-74526560 TTGTATTTTTAGTAAAGACTGGG - Intronic
1151565518 17:74895322-74895344 TTGTATTTTCAGTAGAGCCGGGG - Intergenic
1151893225 17:76963445-76963467 CTGTATTTTCAGTAGAGACAGGG - Intergenic
1151900857 17:77013219-77013241 CAGGAGTTTCAGACAAGCCTGGG + Intergenic
1152027547 17:77821582-77821604 CGGTAGTTTGAGACAAGCCTGGG + Intergenic
1152652365 17:81500710-81500732 TTGTATTTTTAGAAGAGCCGGGG - Intergenic
1152681240 17:81669316-81669338 TTGTATTTTTAGTAAAGGCTGGG + Intronic
1152959409 18:69982-70004 TTGTATTTTTAGTAGAGCCTGGG - Intronic
1153322834 18:3790475-3790497 CGGGATTTTGAGACAAGCCTGGG - Intronic
1153409701 18:4779986-4780008 TTGTATTTTCAGTAAAGACGGGG - Intergenic
1153518882 18:5933281-5933303 CTGGATGTTCATAACAGCCTGGG - Intergenic
1153758537 18:8307629-8307651 CTGTATTTTCAGTAGAGACGGGG - Intronic
1153800969 18:8668298-8668320 TTGTATTTTCAGTAAAGACAGGG + Intergenic
1154044985 18:10895884-10895906 CTGTATTTTTAGTAAAGACAGGG - Intronic
1154151726 18:11911344-11911366 CTGTATTTTTAGTAGAGCCGTGG - Intergenic
1154212414 18:12390984-12391006 CTATATTTTCAGTAGAGGCTGGG - Intergenic
1154391461 18:13940207-13940229 CTGTATTTTCAGTAGAGACAGGG + Intergenic
1155768532 18:29669006-29669028 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1155905490 18:31446104-31446126 CTTCATTTCCAGAAAAGTCTTGG - Intergenic
1155961352 18:31998014-31998036 CTGTATTTTCAGTAGAGACAGGG + Intergenic
1156031909 18:32722749-32722771 CTGGATTTTGAGACCAGCCTGGG + Intronic
1156122211 18:33859744-33859766 TTGTATTTTTAGTAAAGACTAGG - Intronic
1157216049 18:45784393-45784415 CTGTATTTTTAGTAGAGACTGGG + Intergenic
1157724521 18:49953635-49953657 CTGTATTTTAACAAGACCCTAGG + Intronic
1158207595 18:55010836-55010858 CTGTGTTTCCAGAGAAGCCATGG + Intergenic
1158257393 18:55567538-55567560 TTGTATTTTCAGTAGAGACTGGG - Intronic
1158262790 18:55627590-55627612 TTGTATTTTCAGTAAAGACGGGG - Intronic
1158329877 18:56350078-56350100 CAGGAGTTTCAGATAAGCCTAGG - Intergenic
1158921588 18:62197478-62197500 GTGTATTTTTAGACAAGGCTGGG - Intronic
1159361647 18:67412385-67412407 TTGTATTTTCAGTACAGACTGGG + Intergenic
1159516020 18:69458917-69458939 TTGTATTTTTAGTAAAGACTGGG - Intronic
1160052241 18:75444899-75444921 CAGGAGTTTGAGAAAAGCCTGGG + Intergenic
1160111705 18:76038232-76038254 CTGTATTTTTAGTAGAGACTGGG - Intergenic
1160165841 18:76511682-76511704 TTGTATTTTCAGTAAAGACGGGG - Intergenic
1160267004 18:77347091-77347113 TTGTATTTTCAGAAGAGACAGGG - Intergenic
1160862357 19:1242816-1242838 CTGTATTTTTAGAAGAGACGGGG - Intronic
1160917076 19:1502077-1502099 TTGTATTTTCAGTAAAGACCGGG + Intergenic
1161032704 19:2065729-2065751 CTGTATTTTTAGTAGAGACTGGG - Intergenic
1161181447 19:2885726-2885748 CTGTATTTTTAGTAGAGACTGGG + Intergenic
1161182448 19:2893414-2893436 CTGTATTTTCAGTAGAGACGTGG - Intergenic
1161215265 19:3091907-3091929 CTGTATTTTCAGTAGAGACGGGG + Intergenic
1161626185 19:5328280-5328302 CTGTATTTTTAGTAGAGACTGGG + Intronic
1161626265 19:5328755-5328777 CTGTATTTTTAGTAGAGACTGGG - Intronic
1161734236 19:5981026-5981048 TTGTATTTTCAGTAGAGACTGGG + Intergenic
1161771202 19:6231673-6231695 TTGTATTTTCAGTAAAGACGGGG + Intronic
1161827735 19:6580203-6580225 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1161902898 19:7132761-7132783 TTGTATTTTCAGTAAAGACAGGG + Intronic
1161934043 19:7360406-7360428 TTGTATTTTCAGTAGAGACTAGG + Intronic
1162060593 19:8092538-8092560 CTGTATTTTCAGTAGAGACAGGG - Intronic
1162206799 19:9062327-9062349 CAGTAGTTTGAGAACAGCCTGGG - Intergenic
1162240480 19:9349119-9349141 CTGTATTTTTAGTAGAGCCAGGG + Intronic
1162484109 19:10948178-10948200 TTGTATTTTTAGAAAAGACAGGG - Intergenic
1162640242 19:12002822-12002844 CTGGAGTTTGAGAACAGCCTGGG + Intergenic
1162648294 19:12065805-12065827 CTGTATTTTCAGTAAAGACGGGG + Intronic
1162666295 19:12215749-12215771 TTGTATTTTCAGTACAGCCAGGG - Intergenic
1162700213 19:12509373-12509395 CTGTATTTTTAGTAAAGACGGGG + Intronic
1162715316 19:12627452-12627474 TTGTATTTTTAGTAAAGCCGTGG - Intronic
1162767587 19:12929377-12929399 TTGTATTTTCAGTAAAGACGAGG + Intronic
1162962862 19:14137999-14138021 CTGTATTTTCAGTAGAGACGGGG + Intergenic
1163506591 19:17710894-17710916 TTGTATTTTCAGTAAAGACGGGG - Intergenic
1163604773 19:18267968-18267990 CTGTATTTTTAGTAAAGACGGGG + Intronic
1163610830 19:18300744-18300766 CTGTATTTTTAGTAGAGACTGGG + Intergenic
1163733509 19:18964128-18964150 TTGTATTTTCAGTAGAGACTGGG - Intergenic
1163989103 19:20981764-20981786 TTGTATTTTTAGTAAAGCCGGGG - Intergenic
1164021383 19:21309533-21309555 CTGTATTTTCAGTAGAGACAAGG - Intronic
1164236323 19:23338877-23338899 TTGTATTTTCAGAAGAGACGGGG - Intronic
1164443519 19:28298355-28298377 CAGGAGTTTCAGAACAGCCTGGG - Intergenic
1164779934 19:30884139-30884161 TTGTATTTTTAGAAAAGACAGGG + Intergenic
1164979936 19:32606324-32606346 CTGTATTTTCAGTAGAGACGGGG + Intronic
1165426340 19:35747810-35747832 TTGTATTTTTAGTAAAGACTGGG + Intronic
1165537773 19:36463896-36463918 TTGTATTTTTAGTAGAGCCTGGG + Intronic
1165689721 19:37854247-37854269 TTGTATTTTCAGTAAAGACGGGG + Intergenic
1165934103 19:39378731-39378753 TTGTATTTTTAGTAAAGACTGGG - Intronic
1165986483 19:39773587-39773609 CTGTATTTTCAGTAGAGACAGGG - Intergenic
1166086614 19:40480075-40480097 CTGTATTTTTAGTAAAGACAGGG - Intronic
1166164707 19:40979145-40979167 TTGTATTTTCAGTAAAGACAGGG - Intergenic
1166632253 19:44417276-44417298 CAGGATTTTGAGACAAGCCTGGG + Intergenic
1166725008 19:45021745-45021767 TTGTATTTTCAGTAGAGACTGGG + Intronic
1166729587 19:45051485-45051507 TTGTATTTTTAGTAGAGCCTGGG + Intronic
1166924043 19:46253478-46253500 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1167084452 19:47299816-47299838 CTGTATTTTTAGAAGAGACGGGG + Intronic
1167135322 19:47612204-47612226 CTGGATTTTAAGACCAGCCTAGG + Intronic
1167180866 19:47902379-47902401 CTGTATTTTCAGTAGAGACGGGG - Intergenic
1167212900 19:48144674-48144696 TTGTATTTTCAGAAGAGACGAGG + Intronic
1167322233 19:48804369-48804391 TTGTATTTTTAGTAAAGCCAGGG - Intronic
1167842006 19:52129953-52129975 TTGTATTTTCAGTAAAGACGAGG + Intronic
1167842523 19:52133683-52133705 TTGTATTTTTAGAAGAGCCGGGG + Intronic
1167940806 19:52944378-52944400 CTGTATTTTCACAAGAGACGGGG - Intronic
1168596280 19:57680394-57680416 CTGTATTTTCAGTAGAGCGAGGG - Intergenic
1202686370 1_KI270712v1_random:53855-53877 TTGTATTTTCAGTAGAGACTGGG - Intergenic
924960697 2:31671-31693 CTGGAGTTACAGAAAACCCTTGG + Intergenic
925311319 2:2885534-2885556 CTGTATTTTTAGTAAAGACGGGG - Intergenic
925426651 2:3754220-3754242 CTGAATTTGCAGAGAATCCTGGG + Intronic
925612854 2:5717831-5717853 CTGTATTTTCAGTAGAGACAGGG + Intergenic
925811772 2:7708268-7708290 TGCTATTTTCAGAACAGCCTGGG - Intergenic
925896282 2:8474715-8474737 CTATATTTTCAGTAAAGACTGGG - Intergenic
926269014 2:11351049-11351071 CTGTATTTTCAGTAGAGACAGGG - Intergenic
926712189 2:15890536-15890558 CTGCATTTTTACAAGAGCCTAGG + Intergenic
926998974 2:18772364-18772386 TTGTATTTTCAGTAGAGACTGGG - Intergenic
927025632 2:19066091-19066113 CTGTAGTTTGAGACCAGCCTGGG + Intergenic
927800231 2:26091997-26092019 CTGTATTTTTAGTAAAGTCAGGG - Intronic
927892696 2:26762288-26762310 CAGGATTTCCAGACAAGCCTGGG - Intergenic
927987265 2:27420762-27420784 TTGTATTTTCAGTAGAGACTGGG - Intergenic
928506217 2:31955778-31955800 TTGTATTTTCAGTAAAGACAGGG + Intronic
928509427 2:31988372-31988394 CTGTATTTTCAGTAGAGACGGGG - Intronic
928512837 2:32017442-32017464 TTGTATTTTTAGTAAAGACTGGG - Intronic
929584106 2:43102561-43102583 CTGTATTTTCAGAGGAGCCCAGG + Intergenic
929665249 2:43828791-43828813 CTGTATTTTTAGAACAGACAGGG - Intronic
929750208 2:44703603-44703625 TTGTATTTTCAGTAGAGACTGGG - Intronic
930036237 2:47087120-47087142 CTCTGTTTTCAGAAAACCCCAGG - Exonic
930100504 2:47599503-47599525 CTGAATCTTCATAAAAGTCTAGG + Intergenic
930530353 2:52581419-52581441 CTGTATTTTCAGTAGAGACGGGG - Intergenic
930530714 2:52584761-52584783 CTGTCTTTTCAGATAAGCAGGGG + Intergenic
930611060 2:53544171-53544193 TTGTATTTTCAGTAAAGACAAGG + Intronic
930763129 2:55057773-55057795 CAGTAGTTTGAGAACAGCCTGGG + Intronic
930833593 2:55771834-55771856 CTGTAGCTACAAAAAAGCCTTGG - Intergenic
931106397 2:59061217-59061239 TTGTATTTTCAGTAGAGACTGGG - Intergenic
931303790 2:61007906-61007928 CTGTATTTTCAGTAGAGACGGGG - Intronic
931408925 2:62009430-62009452 TTGTATTTTCAGTAGAGACTGGG - Intronic
931589011 2:63860487-63860509 ATGTATTTTCAGAACATCTTTGG + Intronic
933104301 2:78303719-78303741 TTGTATTTTTAGTAAAGACTGGG + Intergenic
933254540 2:80065524-80065546 CTGTATTTTCAGTAGAGACAGGG + Intronic
933453669 2:82493408-82493430 CTGTACTTTTAGAAAAGCTAAGG - Intergenic
933661220 2:84928596-84928618 CAGGAGTTTCAGATAAGCCTGGG + Intergenic
933853953 2:86395580-86395602 TTGTATTTTTAGAAGAGACTAGG + Intergenic
933904341 2:86875038-86875060 CTTTATTTTTAGAAAAGGCATGG + Intergenic
934245351 2:90300952-90300974 TTGTATTTTCAGTAGAGACTGGG + Intergenic
934263394 2:91496077-91496099 TTGTATTTTCAGTAGAGACTGGG - Intergenic
934492823 2:94773353-94773375 GAGTATTTACAGAAAAACCTCGG - Intergenic
934586210 2:95498753-95498775 CAATATTATCAGAAAAGCATGGG - Intergenic
934727447 2:96633103-96633125 CTGTATTTTCAGTAGAGACGGGG - Intronic
934764365 2:96872153-96872175 CTGTATTTTTAGTAAAGACAGGG - Intergenic
935094526 2:99931734-99931756 TTGTATTTTCAGTAGAGACTGGG - Intronic
935878184 2:107535095-107535117 CTGTATCTTCAGAACAGCTCTGG + Intergenic
936367897 2:111877108-111877130 CTTTATTTTTAGAAAAGGCATGG - Intronic
936492855 2:112988865-112988887 CTGTTTTTTCAGCAAAGACTTGG + Intergenic
936519945 2:113205455-113205477 TTGTATTTTTAGTAAAGACTGGG - Intronic
936543564 2:113371705-113371727 TTGTATTTTCAGTAGAGACTGGG + Intergenic
936591453 2:113808536-113808558 TTGTATTTTTAGTAAAGACTAGG + Intergenic
936636734 2:114267243-114267265 CTGGACTTCCAGAAAACCCTGGG + Intergenic
936850870 2:116896105-116896127 CTGTACTTTCAGGAAAAGCTGGG + Intergenic
937326967 2:120995616-120995638 CTGTATTTTTAGTAAAGACAGGG - Intergenic
937553907 2:123130970-123130992 CTGGATATTCAGAAAAGTCATGG - Intergenic
937598753 2:123703589-123703611 CTGTATTTTCAGTAGAGACGGGG + Intergenic
937794605 2:126002205-126002227 CTGTATTTTCACAAAGCCATTGG - Intergenic
937995665 2:127692646-127692668 CTGTAGTTTGAGAACAGACTGGG - Intergenic
938004185 2:127774222-127774244 TTGTATTTTCAGTAAAGACAGGG + Intronic
938417770 2:131118689-131118711 TTGTATTTTCAGTAAAGACGGGG - Intronic
939052873 2:137329537-137329559 CTGTATTTTCAGTAGAGACGGGG + Intronic
939735188 2:145835346-145835368 CAGGAGTTTCAGAACAGCCTGGG - Intergenic
939964261 2:148595054-148595076 CAGGAGTTTCAGACAAGCCTGGG + Intergenic
940753783 2:157658773-157658795 CTGTATTTTAATAAGATCCTCGG - Intergenic
940926925 2:159374116-159374138 CAGGAGTTTGAGAAAAGCCTGGG - Intronic
940958565 2:159756512-159756534 CTGTATTTTCAGTAGAGACGGGG - Intronic
941078442 2:161032909-161032931 TTGTATTTTCAGAAGAGACGGGG - Intergenic
941472163 2:165901493-165901515 TTGTATTTTCAGTAAAGACAAGG + Intronic
941786402 2:169504497-169504519 CTGTATTTTCAGAAGAACTGGGG + Exonic
942115112 2:172721160-172721182 CTGTATTCTTAGAGACGCCTTGG + Intergenic
942316616 2:174702360-174702382 TTGTATTTTTAGTAAAGACTGGG - Intergenic
942339712 2:174930940-174930962 CTGTATTTTCAGTAGAGACAGGG + Intronic
942358606 2:175147676-175147698 ATGTATTTTCATAAAAACCATGG - Intronic
942472724 2:176278221-176278243 TTGTATTTTCAGTAAAGACGGGG + Intronic
942617725 2:177811749-177811771 ATGTATCTGCAGAAAAGTCTAGG - Intronic
942704915 2:178760355-178760377 TTGTATTTTCAGGAGAGACTAGG - Intronic
942981106 2:182082987-182083009 ATGTATACTCAGAAAAGCCTTGG + Intronic
943199886 2:184808317-184808339 TTGTATTTTCAAAAAAGTTTTGG - Intronic
943245814 2:185450168-185450190 TTGTATTTTCAGTAAAGACAGGG + Intergenic
943644358 2:190393026-190393048 CTGTAATTTGAGACCAGCCTGGG - Intergenic
943760054 2:191598082-191598104 GTGTATTTTCAGTAAAGACGGGG + Intergenic
944035893 2:195294140-195294162 TTGTATTTTCAGTAAAGACAGGG - Intergenic
944041609 2:195362066-195362088 TTGTATTTTCAGTAAAGTCGGGG + Intergenic
944072514 2:195689061-195689083 CAGTCTTTTCAGAGAATCCTTGG - Intronic
944076671 2:195740154-195740176 TTGTATTTTCAGTAGAGACTGGG + Intronic
944080136 2:195778427-195778449 CAGTAGTTTGAGAACAGCCTGGG + Intronic
944084848 2:195833925-195833947 CTGTATTTTTAGTAAAGACAGGG + Intronic
944155047 2:196598766-196598788 CTGTATTTTTAGAAGAGACTGGG - Intergenic
944228684 2:197372237-197372259 TTGTATTTTTAGTAAAGACTGGG + Intergenic
944705309 2:202283037-202283059 CTGTATTTTCAGTAGAGACAGGG - Intronic
944769955 2:202903963-202903985 TTGTATTTTTAGTACAGCCTTGG - Intronic
944894205 2:204147413-204147435 TTGTATTTTCAGTAAAGACGAGG + Intergenic
945264216 2:207874400-207874422 TTGTATTTTCAGTAAAGACAGGG - Intronic
945562488 2:211355907-211355929 CAGGATTTTGAGACAAGCCTGGG + Intergenic
945788969 2:214279267-214279289 TTGTATTTTTAGTAAAGACTGGG + Intronic
945896188 2:215484529-215484551 CTGTACTTTCAGAAATTCCCTGG - Intergenic
946086258 2:217176116-217176138 CTGACCTTTCTGAAAAGCCTAGG - Intergenic
946246760 2:218392234-218392256 TTGTATTTTCAGTAAAGACGGGG + Intronic
946490216 2:220141791-220141813 CTGTATTTTTAGAAGAGACAGGG + Intergenic
946580835 2:221126914-221126936 CTCTATTATGAGAAAAGCATAGG - Intergenic
946614424 2:221494429-221494451 TTGTATTTTTAGTAGAGCCTGGG - Intronic
946630861 2:221667159-221667181 CTGTATTTTTAGTAAAGACTGGG - Intergenic
946830435 2:223723059-223723081 TTGTATTTTTAGTAAAGCCGAGG - Intergenic
946959344 2:224967252-224967274 CTGTATTTTCAGTAGAGACGGGG + Intronic
947218521 2:227770903-227770925 ATGTATTTTAAGAATAGGCTGGG + Intergenic
947359456 2:229332867-229332889 CAGGAATTTCAGACAAGCCTGGG + Intergenic
948543465 2:238706523-238706545 CTGTATTTTTAGTAGAGACTGGG - Intergenic
1169100669 20:2945754-2945776 TTGTATTTTCAGAAGAGACAGGG - Intronic
1169116593 20:3070290-3070312 GTGTATTTTCAGTAAAGACGGGG - Intergenic
1169127592 20:3141089-3141111 CTGTATTTTCAGTAGAGACGGGG + Intronic
1169978143 20:11353534-11353556 CTGTCTTTTCACAAAAGCAGAGG - Intergenic
1170088172 20:12559831-12559853 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1170262287 20:14423523-14423545 TTGTATTTTTAGTAAAGCCGGGG - Intronic
1170329966 20:15198131-15198153 CTGTATTTTCAGTAGAGACGGGG + Intronic
1170600551 20:17838331-17838353 TTGTATTTTCAGTAGAGACTGGG + Intergenic
1170626883 20:18036960-18036982 CTGTATTTTCAGTAGAGACGGGG - Intronic
1170642899 20:18171637-18171659 TTGTATTTTCAGTAAAGACAGGG - Intronic
1170772007 20:19341074-19341096 CTGTATTTTCAGAACTCTCTGGG - Intronic
1170844088 20:19947648-19947670 CTTTGTTTTCATAAAAGTCTAGG + Intronic
1170859985 20:20093894-20093916 CTGCAGTTTAAGAAAAGCCTGGG - Intronic
1170992500 20:21316078-21316100 CTGTATTTTCAGTAGAGACGGGG - Intronic
1171115681 20:22523030-22523052 CTTTCTTTCTAGAAAAGCCTTGG + Intergenic
1171152420 20:22838775-22838797 TTGTATTTTTAGTAAAGACTAGG + Intergenic
1171168972 20:22998597-22998619 CTGTTTTTTCTGAATGGCCTTGG + Intergenic
1172242222 20:33420805-33420827 CTGTATTTTTAGTAAAGACAGGG - Intronic
1172266361 20:33618480-33618502 CTGTGTTTTCCCAAAAGTCTAGG - Intronic
1172292405 20:33785507-33785529 CTGTATTTTCAGTAGAGACGGGG + Intronic
1172521676 20:35570984-35571006 CTGTATTTTTAGTAGAGCATTGG + Intergenic
1172743834 20:37191302-37191324 CTGTATTTTTAGTAAAGACAGGG - Intronic
1173046003 20:39512439-39512461 TTGTATTTTCAGTAGAGACTGGG - Intergenic
1173491805 20:43488732-43488754 TTGTATTTTTAGAAAAGACAGGG + Intergenic
1173600032 20:44288138-44288160 CTGTATAGTCAGAAAAACTTTGG - Intergenic
1173627357 20:44483028-44483050 TTGTATTTTCAGTAAAGACAGGG + Intronic
1173862900 20:46295969-46295991 CAGGAGTTTCAGACAAGCCTGGG - Intronic
1173999936 20:47367220-47367242 TTGTATTTTCAGTAAAGACAGGG - Intergenic
1174226050 20:49001210-49001232 TTGTATTTTCAGTAAAGACAGGG + Intronic
1174276125 20:49405563-49405585 CTGTATTTTCAGTAGAGACAGGG - Intronic
1174347656 20:49942648-49942670 TTGTATTTTCAGTAGAGCCGAGG - Intronic
1174350766 20:49966034-49966056 CTGTATCTTTAAAAAAGCCTCGG + Intergenic
1174510039 20:51044235-51044257 TTGTATTTTTAGTAAAGACTGGG + Intergenic
1174571403 20:51504306-51504328 TTGTATTTTCAGTAGAGCCGGGG + Intronic
1174615271 20:51830539-51830561 CTGTATTTTCGGGAAAGACGGGG - Intergenic
1174632213 20:51967774-51967796 TTGTATTTTTAGTAGAGCCTGGG + Intergenic
1175095025 20:56534440-56534462 CTGTATTTTTAGTAAAGACGAGG - Intronic
1175406275 20:58732304-58732326 CAGGAGTTTCAGACAAGCCTGGG - Intergenic
1175563115 20:59949843-59949865 CTGCATTTTAACAAAATCCTTGG + Intergenic
1175667386 20:60871926-60871948 TTGTGTTTTCAGCATAGCCTTGG + Intergenic
1175898924 20:62352389-62352411 CTGGATCACCAGAAAAGCCTGGG + Intronic
1176213381 20:63936669-63936691 TTGTATTTTCAGTAAAGACGGGG - Intergenic
1176711979 21:10158366-10158388 CAGGATTTTGAGAACAGCCTTGG - Intergenic
1177636694 21:23796952-23796974 CTGTATTTTCAGTAGAGACAGGG + Intergenic
1177653330 21:23985473-23985495 CTGGAGTTCCAGAACAGCCTGGG + Intergenic
1177826956 21:26095016-26095038 TTGTATTTTCAGTAAAGACAGGG + Intronic
1177996016 21:28098731-28098753 TTGTATTTTCAGTAGAGACTGGG + Intergenic
1178123507 21:29493422-29493444 CTGTATTTTTAGTAAAGACAGGG + Intronic
1178292292 21:31379142-31379164 TTGTATTTTCAGTAAAGACAAGG + Intronic
1178824410 21:36003827-36003849 TTGTATTTTCAGTAGAGACTAGG + Intronic
1178990342 21:37349787-37349809 TTGTATTTTTAGTAGAGCCTTGG + Intergenic
1179003025 21:37481795-37481817 CAGTAATTCCAGAACAGCCTGGG + Intronic
1179108554 21:38425209-38425231 TTGTATTTTTAGTAAAGACTGGG - Intronic
1179157932 21:38866540-38866562 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1179334999 21:40442682-40442704 TTGTATTTTCAGTAAAGACGGGG + Intronic
1179498355 21:41790219-41790241 GTGTATTTTCAGGAGAGACTGGG - Intergenic
1179775698 21:43660389-43660411 CTGTATTTTTAGTAGAGCCGGGG - Intronic
1181532285 22:23523501-23523523 TTGTATTTTCAGTAGAGACTGGG - Intergenic
1181553742 22:23655627-23655649 TTGTATTTTCAGTAAAGACAGGG - Intergenic
1181641526 22:24202630-24202652 CTGTATTTTCAGTAGAGACGGGG - Intergenic
1181662342 22:24361477-24361499 CTGTATTTTCAGTAGAGACAGGG - Intronic
1181895607 22:26104963-26104985 CTGCATCATCAGAATAGCCTTGG - Intergenic
1182005453 22:26955929-26955951 TTGTATTTTTAGAAAAGACGGGG - Intergenic
1182161692 22:28128746-28128768 CAGTAGTTTGAGACAAGCCTGGG - Intronic
1182367992 22:29791505-29791527 TTGTATTTTCAGTAAAGACGGGG - Intronic
1182594163 22:31405338-31405360 TTGTATTTTCAGTAGAGACTGGG + Intronic
1182641859 22:31774666-31774688 TTGTATTTTCAGTAAAGACGGGG - Intronic
1182744601 22:32595902-32595924 TTGTATTTTTAGTAAAGACTGGG - Intronic
1182856787 22:33524566-33524588 ATGTAATTTCAGAAAAGGGTGGG - Intronic
1183066628 22:35368026-35368048 TTGTATTTTTAGGAAAGACTGGG - Intergenic
1183156966 22:36083095-36083117 TTGTATTTTCAGTAAAGACAGGG + Intergenic
1183375908 22:37465059-37465081 CTGTATTTTCAGTAGAGACAGGG + Intergenic
1183376541 22:37468575-37468597 CTGTATTTTCAGTAGAGACAGGG - Intergenic
1183436860 22:37801388-37801410 TTGTATTTTCAGTAAAGACAGGG + Intergenic
1183450336 22:37890795-37890817 TTGTATTTTCAGTAGAGACTGGG + Intergenic
1183627766 22:39015123-39015145 CTGTATTTTCAGTAGAGACGAGG - Intronic
1183817717 22:40317403-40317425 GTGTATTTTCAGTAAAGACGGGG - Intronic
1183835079 22:40445720-40445742 CTGTATTTTTAGTAAAGACGGGG + Intronic
1183950849 22:41352042-41352064 CAGGAGTTTCAGATAAGCCTGGG - Intronic
1184018988 22:41807986-41808008 CTGTATTTTCAGTAGAGACGGGG - Intronic
1184040543 22:41940556-41940578 CTGTATTTTTAGTAAAGACTGGG + Intronic
1184233461 22:43170700-43170722 CAGGAGTTTCAGACAAGCCTGGG + Intronic
1184949148 22:47827665-47827687 TTGTATTTTCAGTAAAGACGGGG - Intergenic
1185252302 22:49810308-49810330 CAGGAGTTTCAGAACAGCCTGGG + Intronic
1185378406 22:50493997-50494019 TTGTATTTTCAGTAAAGACAGGG - Intergenic
949132414 3:519755-519777 TTGTATTTTCAGAAGAGACAGGG + Intergenic
949540878 3:5031205-5031227 TTGTATTTTCAGTAAAGACGGGG - Intergenic
949707023 3:6830223-6830245 TTGTATTTTCAGTAGAGGCTGGG - Intronic
949764569 3:7511931-7511953 CAGTAGTTTGAGAGAAGCCTGGG + Intronic
949942288 3:9164167-9164189 CTGTATTTTCAGTATAGACGGGG + Intronic
950041926 3:9925288-9925310 TTGTATTTTCAGTAAAGACAGGG + Intronic
950310986 3:11957579-11957601 CTATATTTTCAGTATAGCCAAGG + Intergenic
950827223 3:15836924-15836946 TTGTATTTTTAGTAGAGCCTGGG - Intronic
950916813 3:16654401-16654423 CTGCATTTTCACAAAAGACTAGG - Intronic
951068523 3:18296473-18296495 CTGTATTTTTAGAAGAGACCAGG - Intronic
951204128 3:19908358-19908380 CTGTATTTTTAGTAGAGACTGGG - Intronic
951214391 3:20010266-20010288 TTGTATTTTCAGTAGAGACTGGG + Intronic
951647268 3:24906668-24906690 TTGTATTTTTAGAAAAGACAGGG - Intergenic
951693974 3:25426959-25426981 CTGTATTTTAATAAAAGGATTGG + Intronic
951877650 3:27445116-27445138 CTGTACTTTCACACAAGGCTGGG - Intronic
951930164 3:27956135-27956157 CAGGATTTTCAGACCAGCCTGGG - Intergenic
951967964 3:28409290-28409312 TTGTATTTTCAGTAGAGGCTGGG + Intronic
952293943 3:32044567-32044589 TTGTATTTTCAGTAGAGACTGGG - Intronic
952351420 3:32542578-32542600 TTGTATTTTTAGAAAAGACGGGG + Intronic
952381515 3:32808999-32809021 TTGTATTTTCAGTAGAGACTGGG - Intergenic
952527813 3:34230878-34230900 CTTTATAATCAGAAAAGCCAAGG + Intergenic
952622321 3:35360711-35360733 CTGTATTTTAAAAACATCCTTGG - Intergenic
952627525 3:35424947-35424969 CTATATTTTTGGAATAGCCTGGG - Intergenic
953321524 3:41976690-41976712 TTGTATTTTTAGTAGAGCCTGGG - Intergenic
953483603 3:43273802-43273824 CTCTATTTACAAAAAAGCATAGG + Intergenic
953759231 3:45673703-45673725 CTGGAGTTTAAGAACAGCCTGGG + Intronic
953900587 3:46839738-46839760 CAGGAGTTTCAGACAAGCCTGGG + Intergenic
954070586 3:48140046-48140068 TTGTATTTTTAGTAAAGCCAGGG + Intergenic
954076317 3:48184041-48184063 GTGTATTTTAAGAAAAGACATGG - Intronic
954179728 3:48872300-48872322 TTGTATTTTTAGTAAAGCCAGGG + Intronic
954319195 3:49819599-49819621 CTGTATTTTAAGAAAAGATCTGG - Intergenic
954328443 3:49876412-49876434 TTGTATTTTTAGTAAAGACTGGG - Intergenic
954348816 3:50025248-50025270 TTGTATTTTTAGAAAAGACGGGG - Intronic
954725432 3:52604789-52604811 TTGTATTTTCAGCAGAGACTGGG - Intronic
954884177 3:53857491-53857513 CAGTATTTTGAGACCAGCCTGGG - Intronic
955190596 3:56757894-56757916 TTGTATTTTTAGAAAAGACGGGG + Intronic
955196563 3:56809903-56809925 TTGTATTTTTAGGAAAGACTGGG + Intronic
955475103 3:59328484-59328506 CTTAATTTTCAGAACAGCCCTGG + Intergenic
956106016 3:65819702-65819724 TTGTATTTTTAGTAAAGACTAGG - Intronic
956185238 3:66556188-66556210 CTGTATTTTTAGTAAAGGTTGGG - Intergenic
957067241 3:75534972-75534994 TTGTATTTTCAGTAGAGACTGGG + Intergenic
957909883 3:86607295-86607317 TTGTATTTTCAGTAAAGACGAGG + Intergenic
958430530 3:94035061-94035083 TTGTATTTTCAGTAGAGACTGGG - Intronic
958529933 3:95314871-95314893 CTGTATTTTTAGTAAAGACTGGG - Intergenic
958757776 3:98271273-98271295 CTGTATTTTCAGTAGAGACAGGG - Intergenic
958862822 3:99466002-99466024 CAGGAGTTTGAGAAAAGCCTGGG - Intergenic
958940307 3:100305005-100305027 CAATATTTTCAGAAAAGGCAAGG + Intronic
958955371 3:100460398-100460420 CAGGAGTTTCAGAACAGCCTGGG - Intergenic
959041503 3:101427314-101427336 TTGTATTTTCAGTAAAGACAGGG - Intronic
959491490 3:106994531-106994553 TTGTATTTTTAGTAAAGACTGGG - Intergenic
959633765 3:108538019-108538041 CTGTCATTTCTGAAAGGCCTGGG + Intergenic
959756334 3:109904319-109904341 CTGAAATTTCAGAAAAGCTGGGG + Intergenic
960140292 3:114145458-114145480 CCATATTTTGAGAATAGCCTGGG + Intronic
960222834 3:115135304-115135326 CTTTAATTTTAAAAAAGCCTGGG + Intronic
960298695 3:115975209-115975231 CAGGATTTTGAGACAAGCCTGGG + Intronic
961226695 3:125256187-125256209 CTGTATTTTCAGTAGAGACAGGG - Intronic
961285908 3:125802993-125803015 TTGTATTTTCAGTAGAGACTGGG - Intergenic
961540769 3:127597978-127598000 TTGTATTTTTAGTAAAGACTGGG + Intronic
961856920 3:129881034-129881056 TTGTATTTTCAGTAGAGACTGGG + Intronic
961900831 3:130209908-130209930 TTGTATTTTCAGTAGAGACTCGG + Intergenic
962014491 3:131426084-131426106 TTGTATTTTTAGTAAAGCCGGGG - Intergenic
962533961 3:136310189-136310211 CTGTATTTTTAGTAAAGACGAGG - Intronic
962573244 3:136732780-136732802 TTGTATTTTCAGTAAAGACGGGG + Intronic
962574187 3:136740687-136740709 CAGGAGTTTCAGACAAGCCTGGG - Intronic
962718301 3:138147886-138147908 TTGTATTTTCAGTAAAGACGGGG - Intergenic
962742359 3:138371147-138371169 GTGTATTTTCAGTATAGCCTAGG + Intronic
963191103 3:142474097-142474119 TTGTATTTTCAGTAGAGACTAGG + Intronic
963297311 3:143559994-143560016 CTGTAAATTAAGCAAAGCCTGGG - Intronic
963321942 3:143818477-143818499 TTGTATTTTCAGTAGAGACTGGG + Intronic
964540486 3:157773920-157773942 TTGTATTTTTAGTAAAGCCGGGG - Intergenic
964668250 3:159197162-159197184 CTGCTCATTCAGAAAAGCCTTGG - Intronic
965126368 3:164635116-164635138 CTGTATGTTCAGAATATTCTTGG - Intergenic
965506195 3:169518083-169518105 TTGTATTTTCAGTAAAGACGGGG - Intronic
965513298 3:169593097-169593119 CAGGATTTTCAGACTAGCCTGGG - Intronic
965574164 3:170201460-170201482 TTGTATTTTCTGTAAAGCCAGGG - Intergenic
965738090 3:171843469-171843491 CTGTCTTTTCTTACAAGCCTTGG + Exonic
966151994 3:176875555-176875577 CTGCTTTTGCTGAAAAGCCTGGG + Intergenic
966209214 3:177435258-177435280 TTGTATTTTTAGTAAAGACTGGG + Intergenic
966685222 3:182685940-182685962 CTGTATTCACAGAAAAGATTTGG + Intergenic
966947496 3:184787432-184787454 CTCAATTATCAGAAAAGCCTGGG + Intergenic
966981903 3:185144642-185144664 TTGTATTTTCAGTAGAGACTGGG + Intronic
966996342 3:185284069-185284091 TTGTATTTTTAGTAGAGCCTCGG + Intronic
967068185 3:185938914-185938936 TTGTATTTTTAGTAAAGACTGGG - Intergenic
967096491 3:186181558-186181580 TTGTATTTTTAGTAAAGACTAGG - Intronic
967170485 3:186819477-186819499 CTGTATTTTTAGTAAAGACAGGG + Intergenic
967247812 3:187505679-187505701 TTGTATTTTTAGTAAAGACTGGG + Intergenic
967423291 3:189297596-189297618 CTGGATTTTAAGAAAACCCCAGG + Intronic
967458400 3:189716968-189716990 TTGTATTTTCAGTAGAGACTGGG + Intronic
967783838 3:193468573-193468595 TTGTATTTTTAGAAAAGACAGGG - Intronic
967801443 3:193666577-193666599 CTGTAGTTTGAGACCAGCCTGGG + Intronic
967806858 3:193722133-193722155 CTGTATTTTTAGTAAAGACAGGG + Intergenic
967960471 3:194917860-194917882 CTGTATTTTTAGTAAAGACGCGG - Intergenic
968054756 3:195682943-195682965 TTGTATTTTCAGTAAAGACGGGG + Intergenic
968211766 3:196854866-196854888 TTGTATTTTCAGTAGAGACTGGG + Intergenic
968558591 4:1263997-1264019 CAGTAGTTTCAGACCAGCCTAGG - Intergenic
968734642 4:2289108-2289130 TTGTATTTTTAGAAGAGACTAGG - Intronic
968738555 4:2313691-2313713 TTGTATTTTCAGTACAGACTGGG - Intronic
968843116 4:3022896-3022918 CAGTAGTTTGAGAACAGCCTGGG - Intronic
969011835 4:4071534-4071556 TTGTATTTTCAGTAGAGACTGGG + Intergenic
969454390 4:7292885-7292907 CTGTATTTTCTAATAAGCATGGG - Intronic
969742252 4:9038185-9038207 TTGTATTTTCAGTAGAGACTGGG - Intergenic
969801633 4:9571065-9571087 TTGTATTTTCAGTAGAGACTGGG - Intergenic
969836785 4:9848874-9848896 TTGTATTTTTAGTAAAGCCGGGG + Intronic
969958389 4:10916530-10916552 CTGAAGTTCAAGAAAAGCCTGGG - Intergenic
970614015 4:17751133-17751155 TTGTATTTTTAGTAAAGCCAGGG - Intronic
970698444 4:18706022-18706044 CTGTAATCCCAAAAAAGCCTGGG - Intergenic
971744242 4:30558669-30558691 TTGTATTTTTAGTAAAGACTGGG + Intergenic
972184994 4:36517915-36517937 CTGTAAATTCAGATAAGCCTGGG + Intergenic
972348417 4:38212905-38212927 CTGTATTTTCAGTAGAGACAGGG - Intergenic
972394060 4:38642838-38642860 TTGTATTTTCAGTAAAGACGGGG + Intergenic
972980753 4:44697971-44697993 TTGTATTTTCAGTAAAGCTGCGG - Intronic
973259824 4:48151657-48151679 TTGTATTTTCAGTAGAGCCGGGG + Intronic
973323642 4:48835104-48835126 TTGTATTTTCAGTAGAGACTGGG + Intronic
973598895 4:52521617-52521639 CTGGAGTTCCAGACAAGCCTGGG + Intergenic
973699786 4:53525307-53525329 CTGTATTTTCAGTAGAGTCCAGG - Intronic
973807860 4:54542944-54542966 CTGCTTTTTCAGAATGGCCTGGG - Intergenic
974069816 4:57113320-57113342 TTGTATTTTTAGGAAAGACTGGG + Intergenic
974832233 4:67203792-67203814 CTGTATTTTCTGAAATACTTAGG + Intergenic
974844266 4:67332045-67332067 CTGTCTTTCCAGAATAGCTTTGG - Intergenic
974936243 4:68412618-68412640 TTGTATTTTCAGTAGAGACTGGG - Intergenic
975268672 4:72402742-72402764 CTGTTTTTACAGAATATCCTTGG + Intronic
975833751 4:78398808-78398830 TTGTATTTTTAGTAAAGACTGGG - Intronic
976104460 4:81601945-81601967 TTGTATTTTTAGTAAAGACTGGG - Intronic
976285687 4:83369049-83369071 ATATATTTTAAGATAAGCCTGGG - Intergenic
976503420 4:85817986-85818008 CTTTATTTTTAAAAAGGCCTTGG - Intronic
976729847 4:88250733-88250755 TTGTATTTTTAGTAAAGACTGGG + Intergenic
976840955 4:89431856-89431878 TTGTATTTTCAGTAGAGACTGGG - Intergenic
976868290 4:89758232-89758254 TTGTATTTTTAGTAAAGACTGGG + Intronic
977728361 4:100323401-100323423 CTGGAGTTCCAGATAAGCCTGGG - Intergenic
977851548 4:101836305-101836327 TTGTATTTTCAGTAGAGACTGGG - Intronic
977851746 4:101838538-101838560 GTTAATTTTCAGAAAAGCCTTGG - Intronic
978463199 4:108980421-108980443 GTGTATTTGCAGACAAGCTTTGG + Intronic
978689278 4:111486796-111486818 TTGTATTTTTAGAAGAGACTGGG - Intergenic
979710501 4:123773404-123773426 TTGTATTTTTAGTAAAGACTGGG - Intergenic
979802059 4:124922903-124922925 CAGTATTTTGAGACCAGCCTGGG - Intergenic
979952282 4:126908008-126908030 TTGTATTTTCAGTAAAGACAGGG + Intergenic
979978981 4:127231271-127231293 TTGTATTTTTAGTAAAGACTGGG - Intergenic
980062929 4:128151774-128151796 CTGTATTTTCAGTAGAGACAAGG + Intronic
980900887 4:138904187-138904209 TTGTATTTTTAGTAAAGACTGGG - Intergenic
980984106 4:139678859-139678881 GTATATTTACAGAAAAGGCTGGG + Intronic
981532769 4:145768335-145768357 TTGTATTTTCAGAAGAGACAGGG + Intronic
981603364 4:146517288-146517310 TTGTATTTTTAGTAAAGACTGGG - Intronic
981658492 4:147139144-147139166 CAATATTTTCAGAAATGACTTGG - Intergenic
981709306 4:147693129-147693151 TTGTATTTTCAGTAAAGACGGGG - Intergenic
981801432 4:148662114-148662136 TTGTATTTTCAGTAGAGACTGGG + Intergenic
982004627 4:151051794-151051816 CTGTATTTTTAGTAGAGACTGGG + Intergenic
982026513 4:151257706-151257728 CTGGAGTTTGAGAACAGCCTGGG + Intronic
982512495 4:156300640-156300662 TTGTATTTTCAGAAGAGACGGGG - Intergenic
982673325 4:158348219-158348241 CAGGAGTTTGAGAAAAGCCTGGG - Intronic
982694462 4:158583662-158583684 CTGTATTTTCAGAAAAGCCTAGG - Intronic
983124558 4:163934348-163934370 CAGTAGTTTCAGACAAACCTGGG + Intronic
983301303 4:165929362-165929384 TTGTATTTTCAGTAAAGACGAGG - Intronic
983443024 4:167812199-167812221 CTCCATTTCCAGAAATGCCTTGG + Intergenic
983502901 4:168520150-168520172 TTGTATTTTCAGTAGAGACTGGG - Intronic
983860253 4:172697187-172697209 CAGTATTTTCAGAAATGCTAAGG - Intronic
983869434 4:172807993-172808015 TTGTATTTTTAGTAAAGACTGGG + Intronic
984010110 4:174360440-174360462 CTGTATTTTCAGTAGAGTCAGGG - Intergenic
984033884 4:174640919-174640941 CTGTATTTTCAAGAAAGCTGAGG - Exonic
984077111 4:175196981-175197003 CTGTATTTTCAGTCAAGACGGGG - Intergenic
984378303 4:178959638-178959660 TTGTATTTTCAGTAAAGACAGGG + Intergenic
984419711 4:179505078-179505100 TTGTATTTTTAGTAAAGCCAGGG + Intergenic
984634795 4:182099170-182099192 CTGTAGTTTGAGACCAGCCTGGG - Intergenic
984722303 4:182985902-182985924 CAGGATTTTGAGAATAGCCTGGG + Intergenic
985223730 4:187736539-187736561 CAATATTTTCGGAAAAGCTTTGG - Intergenic
985916505 5:2922934-2922956 CTGTATTCACTGAAAGGCCTAGG - Intergenic
985973692 5:3397851-3397873 TTGTATTTTCAGTAGAGACTGGG + Intergenic
986382613 5:7201865-7201887 CTGTGTTCTCAGAAAACACTTGG + Intergenic
986488567 5:8265919-8265941 TTGTATTTTTAGTAAAGACTGGG - Intergenic
987224564 5:15826589-15826611 TTGTATTTTCAGTAAAGACGGGG + Intronic
987225002 5:15831054-15831076 CTGTATTTTCATCAAAGGCATGG - Intronic
987368306 5:17170160-17170182 CTGTATTTTCAGTAGAGACGGGG - Intronic
987480332 5:18448096-18448118 TTGTATTTTCAGTAGAGACTGGG + Intergenic
987621922 5:20346059-20346081 CTGCATTTTCAGAAAAGGGTTGG - Intronic
987703106 5:21427088-21427110 TTGTATTTTTAGAATAGACTGGG + Intergenic
987976262 5:25019017-25019039 CTGTATTTTTAGGAAAGACCTGG + Intergenic
988134094 5:27146925-27146947 CTGTATTTTCAGTAGAGACTGGG - Intergenic
988489377 5:31693412-31693434 CTGTATTTTTAGTAAAGACGGGG + Intronic
989050742 5:37317314-37317336 TTGTATTTTCAGAAGAGACGGGG - Intronic
989343543 5:40404072-40404094 TTGTATTTTTAGTAAAGACTGGG + Intergenic
989581628 5:43038751-43038773 CAGGAGTTTGAGAAAAGCCTGGG - Intergenic
989988551 5:50733127-50733149 TTGTATTTTTAGTAAAGACTGGG - Intronic
990116331 5:52396655-52396677 CAGGAGTTTGAGAAAAGCCTGGG + Intergenic
990119787 5:52436978-52437000 TTGTATTTTTAGAAGAGACTGGG - Intergenic
990575370 5:57118709-57118731 CTGTATTTTCAGTAGAGACAGGG - Intergenic
990716110 5:58638968-58638990 CTGTGCCATCAGAAAAGCCTTGG - Intronic
990979095 5:61585724-61585746 TTGTATTTTTAGTAAAGACTGGG + Intergenic
991365096 5:65859966-65859988 CTGTATTTTTAGTAAAGACGGGG - Intronic
991519106 5:67475151-67475173 CTAAATTTTCAGGAAAGCCCTGG - Intergenic
991658655 5:68928394-68928416 TTGTATTTTTAGTAAAGACTGGG - Intergenic
991673177 5:69067791-69067813 CTGTATTTTTAGTAAAGACGGGG + Intergenic
992159125 5:73983544-73983566 CTGTTATTTGAGAAAAGACTTGG + Intergenic
992254105 5:74904562-74904584 CTGTATTTTTAGTAAAGACGGGG + Intergenic
992425748 5:76655619-76655641 TTGTATTTTCAGTACAGCCGGGG + Intronic
992653111 5:78881057-78881079 TTGTATTTTTAGTAGAGCCTGGG - Intronic
993185579 5:84614794-84614816 TTGTATTTTCAGGAAAGATTAGG + Intergenic
993417473 5:87653022-87653044 CAGGAGTTTCAGACAAGCCTGGG - Intergenic
993652289 5:90536410-90536432 TTGTATTTTTAGAAAAGACGGGG - Intronic
994240663 5:97416633-97416655 TTGTATTTTCAGTAGAGCCGGGG + Intergenic
994425423 5:99578402-99578424 TTGTATTTTAAGATTAGCCTAGG - Intergenic
994435917 5:99733833-99733855 TTGTATTTTAAGATTAGCCTAGG + Intergenic
994449493 5:99924086-99924108 TTGTATTTTCAGTAGAGACTGGG - Intergenic
994560113 5:101358338-101358360 CTGTATTTTTAGTAGAGACTGGG - Intergenic
994626235 5:102222998-102223020 CTGTATTTACAGAAACCCATGGG + Intergenic
994689762 5:103002756-103002778 CTGCATTTTCACAAGACCCTTGG - Intronic
995072078 5:107935307-107935329 GTGTTTTTACAGAAAAGCTTAGG - Intronic
996073152 5:119158098-119158120 CAGGAGTTTAAGAAAAGCCTGGG - Intronic
996223905 5:120965922-120965944 CTTTATTCTTTGAAAAGCCTAGG - Intergenic
996347783 5:122505941-122505963 CTGACTATTCAGATAAGCCTTGG + Intergenic
996406505 5:123110736-123110758 CTGTATTTTTAGTAGAGACTGGG + Intronic
996485270 5:124026475-124026497 TTGTATTTTCAGTAAAGACAGGG - Intergenic
996608182 5:125348473-125348495 CTGTATTTCCACAAAAGCGTAGG + Intergenic
996842388 5:127861480-127861502 TTGTATTTTCAGTAAAGACGGGG - Intergenic
997017905 5:129958738-129958760 CAGGAGTTTCAGACAAGCCTGGG - Intronic
998016551 5:138736665-138736687 CAGGAGTTTCAGAACAGCCTGGG + Intronic
998027351 5:138829875-138829897 CTGTATTTTTAGTAGAGACTGGG - Intronic
998665185 5:144288795-144288817 CTGTATTTTTAGTAAAGACGGGG - Intronic
998677239 5:144423473-144423495 ATGTATTTTCTGAAAGGGCTGGG - Intronic
998735548 5:145135589-145135611 CTGTGTACTCAGAAAAACCTGGG + Intergenic
998826129 5:146103329-146103351 CTGTATTTTTAGTAAAGACAGGG + Intronic
999126293 5:149248515-149248537 CTGTATTTTTAGTAAAGACCGGG - Intronic
999158189 5:149473485-149473507 CTGTATTTTCAGACAAGATCGGG - Intergenic
999993833 5:157072817-157072839 CAGGAGTTTCAGAACAGCCTGGG - Intergenic
1000077818 5:157810204-157810226 CCCAATTTTCAGAAAAGCATTGG + Intronic
1000079470 5:157831362-157831384 TTGTATTTTCAGTAAAGACAAGG + Intronic
1000080226 5:157838293-157838315 TTGTATTTTTAGTAAAGTCTGGG + Intronic
1000894992 5:166844913-166844935 CTGTATTTTCAGTAGAGACAGGG + Intergenic
1000922850 5:167159113-167159135 TTGTATTTTCAGTAGAGACTGGG + Intergenic
1001199691 5:169704987-169705009 TTGTATTTTCAGTAAAGACAAGG - Intronic
1001339435 5:170829825-170829847 TTGTATTTTCAGTAGAGCCAGGG - Intergenic
1001342033 5:170855948-170855970 TTGTATTTTCAGGAGAGACTTGG + Intergenic
1001603983 5:172947009-172947031 TTGTATTTTTAGTAAAGACTGGG - Intronic
1001700389 5:173702422-173702444 CTGGATTGGCACAAAAGCCTGGG - Intergenic
1001906018 5:175473857-175473879 CTGTATTTTTAGTAAAGACAGGG + Intergenic
1001992217 5:176127342-176127364 TTGTATTTTCAGTAAAGACGGGG - Intronic
1002028154 5:176409585-176409607 CTGTATTTTTAGTAAAGACGGGG + Intronic
1002116994 5:176970096-176970118 TTGTATTTTCAGTAGAGACTGGG - Intronic
1002143620 5:177161173-177161195 CAGTAGTTTGAGACAAGCCTGGG + Intronic
1002224656 5:177710827-177710849 TTGTATTTTCAGTAAAGACGGGG + Intronic
1002589412 5:180279128-180279150 CTGTATTTTTAGCAAAGACGGGG + Intronic
1002633824 5:180597427-180597449 TTGTATTTTCAGTACAGCCAGGG + Intergenic
1003214055 6:4092681-4092703 TTGTATTTTCAGTAAAGACAGGG - Intronic
1003378920 6:5604537-5604559 CTGTGGTTTCAGAGACGCCTGGG - Intronic
1003657025 6:8021424-8021446 TTGTATTTTCAGTAAAGACAGGG - Intronic
1003944306 6:11059499-11059521 TTGTATTTTTAGTAGAGCCTGGG + Intergenic
1004088288 6:12473281-12473303 TTGTATTTTTAGTAAAGACTGGG + Intergenic
1004223249 6:13764961-13764983 CTGTATTTTTAGTAGAGCCAGGG + Intergenic
1004367419 6:15023750-15023772 CTGTATTTTTAGTAAAGACGGGG - Intergenic
1004375258 6:15085536-15085558 TTGTATTTTCAGTAAAGACGGGG - Intergenic
1004382439 6:15144148-15144170 TTGTATTTTTAGTAGAGCCTGGG - Intergenic
1004425472 6:15504175-15504197 CTGCTTTTTCAGCAGAGCCTTGG + Intronic
1004584823 6:16989302-16989324 TTGTATTTTCAGTAAAGACGGGG - Intergenic
1004680960 6:17894010-17894032 TTGTATTTTCAGTAAAGACAGGG + Intronic
1004736240 6:18409203-18409225 TTGTATTTTCAGTAAAGACAGGG - Intronic
1004905259 6:20231914-20231936 CAGGATTTTGAGAACAGCCTGGG + Intergenic
1005216355 6:23532818-23532840 TTGTATTTTCAGTAAAGACGTGG + Intergenic
1005334328 6:24778294-24778316 CTGGACTTTGAGAACAGCCTGGG + Intronic
1005621119 6:27621203-27621225 CTGTATTTTTAGTAGAGACTGGG + Intergenic
1005629936 6:27697805-27697827 TTGTATTTTCAGTAGAGACTGGG + Intergenic
1005750320 6:28876039-28876061 TTGTATTTTTAGAAGAGACTGGG + Intergenic
1005946121 6:30597140-30597162 CTGTATTTTAAGAATAAGCTCGG - Intronic
1006233762 6:32609138-32609160 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1006361114 6:33587827-33587849 CAGGAGTTTGAGAAAAGCCTGGG + Intergenic
1006370140 6:33639204-33639226 TTGTATTTTTAGTAAAGACTGGG - Intronic
1006461741 6:34163271-34163293 GTATATTTTCAGTAAAGACTGGG + Intergenic
1006476338 6:34257018-34257040 GTGTATTTTTAGTAGAGCCTGGG - Intergenic
1006494058 6:34408678-34408700 CTGTATTTTTAGTAAAGACGGGG + Intronic
1006580739 6:35076247-35076269 TTGTATTTTTAGTAAAGACTGGG - Intronic
1006780405 6:36628446-36628468 CTGTATTTTCAGTAGAGACGGGG - Intergenic
1007172346 6:39872658-39872680 TTATATTTTCACAAAAGCCCTGG + Intronic
1007218906 6:40263017-40263039 CTGTACTATCAGAAAAGTCGGGG + Intergenic
1007267927 6:40611264-40611286 TTGTATTTTCAGTAAAGACAGGG + Intergenic
1007464226 6:42040677-42040699 TTGTATTTTCAGTAGAGACTGGG - Intronic
1007561791 6:42815362-42815384 TTGTATTTTCAGTAAAGACAGGG + Intronic
1008632139 6:53372134-53372156 TTGTATTTTCAGTAGAGACTGGG - Intergenic
1008738553 6:54577058-54577080 CTGTATTTTTAGTAAAGACGGGG + Intergenic
1009309344 6:62131054-62131076 CTGTATTTTAAAAATAGCCCAGG - Intronic
1009571727 6:65393565-65393587 CTGCATTTGCAGAAATGCATAGG - Intronic
1009745621 6:67811308-67811330 CTGTATTTTTAGAAGAGACAGGG - Intergenic
1009973066 6:70645139-70645161 TTGTATTTTTAGAAAAGACGGGG - Intergenic
1010485062 6:76401059-76401081 CATTATTTTCGGCAAAGCCTAGG + Intergenic
1010690247 6:78902596-78902618 CTGTATTTTTAGAAGAGACAGGG - Exonic
1010732064 6:79401631-79401653 CTGTATTTTTAGTAGAGACTGGG + Intergenic
1010811174 6:80300258-80300280 CAGGATTTTGAGACAAGCCTGGG - Intronic
1011441509 6:87391904-87391926 TTGTATTTTTAGTAAAGACTGGG + Intronic
1011486147 6:87844148-87844170 CTGTATTTTTAGTAGAGACTGGG + Intergenic
1012112477 6:95254810-95254832 CTGCATTTTAACAAAACCCTTGG - Intergenic
1012274341 6:97253630-97253652 CTGTATTTTTAGTAAAGACAGGG + Intronic
1012281457 6:97332461-97332483 CTGTATTTTCAGTAGAGACGGGG + Intergenic
1012780354 6:103549210-103549232 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1013116506 6:107107633-107107655 CTGTATTTTCAGTAGAGACGGGG + Intronic
1013228554 6:108139890-108139912 CTGGAGTTTGAGAACAGCCTGGG + Intronic
1013245656 6:108284651-108284673 TTGTATTTTTAGAAAAGACAGGG - Intergenic
1013252061 6:108344283-108344305 TTGTATTTTCAGAAGAGACAGGG + Intronic
1013784792 6:113767697-113767719 TTGTATTTTCAGTAAAGACAAGG - Intergenic
1014011370 6:116479753-116479775 TTGTATTTTTAGTAAAGACTGGG + Intergenic
1014445010 6:121516845-121516867 CAGGATTTTGAGACAAGCCTGGG + Intergenic
1014451354 6:121585483-121585505 CTGTATTTTCAGTAGAGACGGGG - Intergenic
1014620563 6:123661640-123661662 CAGGAGTTCCAGAAAAGCCTGGG - Intergenic
1014768518 6:125434801-125434823 CTGTATTTGAAGAAAAGTATGGG + Intergenic
1014940619 6:127434119-127434141 TTGTATTTTTAGTAAAGACTGGG + Intergenic
1015176248 6:130312281-130312303 CTGCTTTTTGATAAAAGCCTTGG - Intronic
1015493198 6:133852477-133852499 TTGTATTTTTAGAAAAGACAGGG - Intergenic
1015498671 6:133907910-133907932 CTGGAGTTTCAGACCAGCCTGGG - Intergenic
1015520760 6:134129030-134129052 CTGTATTTTTAGTAAAGACGGGG + Intergenic
1015553070 6:134432403-134432425 CAGTAGTTTCAGACCAGCCTGGG - Intergenic
1016238197 6:141893465-141893487 TTGTATTTTCAGTAAAGACAGGG - Intergenic
1016587243 6:145703263-145703285 CTGTATTTTCAGGAGAGACGGGG + Intronic
1016731928 6:147436792-147436814 GTGTATTTTTAGAACAGTCTGGG - Intergenic
1016824784 6:148378224-148378246 TTGTATTTTCAGTAAAGGCGGGG + Intronic
1016961014 6:149672771-149672793 TTGTATTTTTAGTAAAGACTGGG - Intronic
1016968666 6:149742332-149742354 TTGTATTTTTAGAAGAGACTAGG + Intronic
1017078305 6:150640476-150640498 CTGTATTTTCAGGGATGCTTTGG + Intronic
1017176865 6:151513435-151513457 TTGTATTTTCAGTAAAGACAGGG - Intronic
1017356241 6:153512655-153512677 TTGTATTTTTAGTAAAGCCGGGG + Intergenic
1017360556 6:153564432-153564454 TTGTATTTTCAGTAAAGACAGGG + Intergenic
1017450772 6:154552545-154552567 CTGTATTTTCAGTAGAGACGGGG + Intergenic
1017484703 6:154891872-154891894 CTGTATTTTTAGTAGAGCCTGGG + Intronic
1017560270 6:155620028-155620050 TTGTATTTTCAGAAGAGACAGGG - Intergenic
1017833327 6:158152341-158152363 TTGTATTTTTAGTAGAGCCTTGG - Intronic
1017902852 6:158733499-158733521 CTGTATTTTCAGTAGAGACAGGG + Intronic
1018240160 6:161766480-161766502 CTGTATTTTCAGTAGAGACGGGG + Intronic
1018300603 6:162398561-162398583 TTGTATTTTTAGTAAAGACTGGG + Intronic
1019220403 6:170468621-170468643 CTTTATTTGCTGAAAAGCATTGG - Intergenic
1019773290 7:2897096-2897118 ATGTGTCTTGAGAAAAGCCTGGG + Intergenic
1019826771 7:3291009-3291031 TTGTATTTTCAGTAGAGACTGGG + Intergenic
1020015193 7:4827190-4827212 TTGTATTTTCAGTAAAGACGGGG - Intronic
1020053661 7:5101452-5101474 CTGTATTTTTAGTAAAGACAGGG + Intergenic
1020145444 7:5638841-5638863 CTGGAGTTTAAGAACAGCCTGGG - Intronic
1020270552 7:6592392-6592414 CTGTATTTTCAGTAGAGACAGGG - Intronic
1021281595 7:18726285-18726307 CTGTATTTTCACTCAAGGCTTGG - Intronic
1021726004 7:23548687-23548709 TTGTATTTTTAGTAAAGACTGGG + Intergenic
1022011848 7:26314823-26314845 TTGTATTTTCAGTAAAGACAGGG - Intronic
1022026221 7:26450242-26450264 CAGTATTTTAAGATCAGCCTGGG - Intergenic
1022155103 7:27652954-27652976 TTGTATTTTTAGTAAAGACTGGG - Intronic
1022988831 7:35686891-35686913 CTGTATTTTCAGTAGAGACGGGG - Intronic
1023053484 7:36273371-36273393 CTGTTTTTTAAAAAAAGCCAGGG - Intronic
1023115616 7:36859122-36859144 CTGTAGATTCAGAGAAACCTAGG + Intronic
1023446517 7:40237269-40237291 TTGTATTTTCAGTAAAGACAAGG - Intronic
1023508826 7:40928770-40928792 TTGTATTTTCAGTAGAGACTGGG + Intergenic
1023599668 7:41869204-41869226 CTCCAGTTTAAGAAAAGCCTTGG + Intergenic
1023638138 7:42233816-42233838 TTGTCTTTTCATTAAAGCCTAGG - Intronic
1023829978 7:44033483-44033505 TTGTATTTTCAGTAAAGACGGGG - Intergenic
1023853872 7:44168615-44168637 CTGTATTTTCAGTAGAGACGGGG + Intronic
1023946808 7:44809644-44809666 CTGTATTTTCAGTAGAGACGGGG + Intronic
1024754290 7:52511418-52511440 CTGTATTTTCAGTAGAGACAGGG + Intergenic
1025100934 7:56134543-56134565 CAGTAGTTCAAGAAAAGCCTGGG - Intergenic
1025154946 7:56596373-56596395 TTGTATTTTCAGTAAAGACGGGG - Intergenic
1025860414 7:65321710-65321732 TTGTATTTTCAGTAGAGGCTGGG + Intergenic
1026061245 7:67028373-67028395 TTGCATTTTCAGAAAAGACGGGG - Intronic
1026409981 7:70110341-70110363 CTGTATTTTTAGTAAAGACAGGG - Intronic
1026505330 7:70977686-70977708 CTGTATTTTTAAAAAAAACTAGG - Intergenic
1026676265 7:72431100-72431122 TTGTATTTTCAGTAAAGACAGGG + Intronic
1026780072 7:73260309-73260331 TTGTATTTTCAGTAAAGACGGGG + Intergenic
1027020927 7:74813727-74813749 TTGTATTTTCAGTAAAGACGGGG + Intronic
1027067098 7:75132197-75132219 TTGTATTTTCAGTAAAGACGGGG - Intronic
1027171292 7:75874649-75874671 TTGTATTTTCAGTAAAGACGGGG - Intronic
1027224625 7:76236136-76236158 TTGTATTTTCAGTAAAGACGGGG - Intronic
1027253831 7:76417229-76417251 TTGTATTTTCAGTAAAGACAGGG + Intronic
1027345147 7:77251974-77251996 TTGTATTTTCAGTAAAGACGGGG - Intronic
1027427810 7:78079780-78079802 CTAAATTTTCAGAAATGCCTGGG + Intronic
1028751778 7:94391122-94391144 TTGGAGTTTAAGAAAAGCCTAGG + Intergenic
1028828331 7:95299912-95299934 ATGTATTTTCAGGTAAGCCAGGG + Intronic
1029092467 7:98058724-98058746 TTGTATTTTTAGTAAAGGCTGGG - Intergenic
1029740292 7:102487755-102487777 TTGTATTTTCAGTAAAGACGGGG - Intronic
1029758288 7:102586929-102586951 TTGTATTTTCAGTAAAGACGGGG - Intronic
1029776226 7:102686007-102686029 TTGTATTTTCAGTAAAGACGGGG - Intergenic
1029969510 7:104775448-104775470 CTATATTTCCAAAGAAGCCTTGG + Intronic
1029998654 7:105034438-105034460 CAGGAGTTTCAGAACAGCCTGGG - Intronic
1030190140 7:106802332-106802354 CTCTCTTTTCTGAAAAGCCTGGG + Intergenic
1030303060 7:107993304-107993326 TTGTATTTTCAGTAGAGCCGGGG + Intronic
1030329561 7:108256841-108256863 CTGTATTTTTAGTAGAGACTGGG - Intronic
1030871474 7:114761165-114761187 CTACATTTTCTGAAAAGACTTGG - Intergenic
1031192648 7:118574355-118574377 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1031409788 7:121427700-121427722 CTGGAGTTTGAGACAAGCCTGGG - Intergenic
1031952761 7:127909492-127909514 CTGTACTTTCAGTCCAGCCTTGG - Intronic
1032147477 7:129396931-129396953 CTGTTTTTTCAGAAAAGTTTTGG + Intronic
1032234381 7:130107669-130107691 TTGTATTTTTAGTAAAGACTGGG - Intronic
1032588100 7:133166512-133166534 TTGTATTTTCAGTAGAGACTGGG - Intergenic
1033082483 7:138311312-138311334 TTGTATTTTGAGTAAAGACTGGG - Intergenic
1033167419 7:139052431-139052453 TTGTATTTTCAGTAGAGACTGGG - Intronic
1033315499 7:140293864-140293886 CTGTATTTTTAGTAGAGCCGGGG + Intronic
1033914725 7:146309627-146309649 TTGTATTTTCAGTAAAGACAGGG - Intronic
1034013699 7:147558913-147558935 TTGTATTTTTAGAAAAGACCAGG + Intronic
1034107626 7:148503826-148503848 AAATATTTTCAGAAAAGCATGGG + Intergenic
1034121784 7:148634758-148634780 TTGTATTTTTAGACAAGACTGGG + Intergenic
1034287301 7:149895624-149895646 CAGGAGTTTCAGAACAGCCTGGG + Intergenic
1034343941 7:150374356-150374378 CTGTAGTTTCATAAAGGCCCAGG - Intronic
1034516749 7:151586986-151587008 TTGTATTTTTAGTAAAGGCTTGG - Intronic
1034523835 7:151641717-151641739 CTGGAGTTTCAGACCAGCCTGGG - Intronic
1034556276 7:151852320-151852342 TTGTATTTTCAGTAAAGACGGGG - Intronic
1034663823 7:152797287-152797309 CAGGAGTTTCAGAACAGCCTGGG - Intronic
1035200087 7:157257560-157257582 CTGTATTTTTAGCAAAGACAGGG - Intronic
1035309473 7:157956133-157956155 CTGTTTGATGAGAAAAGCCTAGG + Intronic
1035988548 8:4461913-4461935 CTGTATTTTTAGAAGAGACGGGG + Intronic
1036247455 8:7130737-7130759 TTGTATTTTCAGTAGAGACTGGG - Intergenic
1036253350 8:7183627-7183649 TTGTATTTTCAGTAGAGACTGGG + Intergenic
1036364145 8:8103851-8103873 TTGTATTTTCAGTAGAGACTGGG - Intergenic
1036438617 8:8759493-8759515 CTGGAGTTTGAGACAAGCCTGGG + Intergenic
1036481905 8:9147511-9147533 CTGCATGTTAGGAAAAGCCTTGG + Intronic
1036894407 8:12621341-12621363 TTGTATTTTCAGTAGAGACTGGG + Intergenic
1036947659 8:13109709-13109731 GTGTATTTTCAGTAGAGACTGGG - Intronic
1037127540 8:15369123-15369145 TTGTATTTTCAGTAAAGACGGGG - Intergenic
1037171533 8:15898753-15898775 TTGTATTTTCAGTAAAGGCAGGG + Intergenic
1037286258 8:17303780-17303802 TTGTATTTTCAGTAGAGACTGGG + Intronic
1037339073 8:17823164-17823186 TTGTATTTTCAGTAGAGACTGGG - Intergenic
1037466271 8:19163527-19163549 TTGTATTTTCAGTAGAGACTGGG - Intergenic
1038264927 8:26031606-26031628 TTGTATTTTTAGTAAAGTCTGGG + Intronic
1038412125 8:27367012-27367034 CTGGAGTTCTAGAAAAGCCTGGG + Intronic
1038576166 8:28704840-28704862 TTGTATTTTCAGTAGAGACTGGG + Intronic
1038821800 8:30958880-30958902 TTGTATTTTTAGAAAAGACGGGG - Intergenic
1039275357 8:35928960-35928982 CTGTATTTTTAGTAGAGACTAGG - Intergenic
1039318934 8:36406780-36406802 CAGGATTTTCAGAACAGCCTGGG + Intergenic
1039439792 8:37587158-37587180 CTGCATTTCCAGGAAAGCCTTGG + Intergenic
1039691392 8:39868360-39868382 TTGTATTTTCAGTAAAGACAGGG - Intergenic
1039803336 8:40978687-40978709 TTGTATTTTCAGTAAAGACAGGG + Intergenic
1039812226 8:41059332-41059354 CTGTATTTTCAGTAGAGACGGGG - Intergenic
1039917080 8:41868029-41868051 TTGTATTTTTAGTAAAGGCTGGG + Intronic
1040549022 8:48424154-48424176 ATGTATTTTCAGAAAGTCTTGGG + Intergenic
1040829596 8:51662343-51662365 TTGTATTTTCAGTAGAGACTGGG - Intronic
1041763209 8:61389363-61389385 TTGTATTTTTAGAAGAGACTAGG - Intronic
1041829519 8:62138109-62138131 TTGTATTTTTAGTAAAGACTTGG - Intergenic
1042209299 8:66362986-66363008 TTGTATTTTCAGTAAAGACGGGG + Intergenic
1042285318 8:67103625-67103647 TTGTATTTTCAGTAGAGACTGGG - Intronic
1042380691 8:68110313-68110335 CTGTATAGTCAGAACAGCATGGG + Intronic
1042505429 8:69554803-69554825 CTGTATTTTCAGTAAAGACGGGG - Intronic
1042563376 8:70090396-70090418 CTGTATTTTTAGTAAAGACGGGG + Intergenic
1043433596 8:80217354-80217376 TTGTATTTTCAGTAAAGACAGGG + Intronic
1044573358 8:93743552-93743574 CTGTATTTTCAGTAGAGACAAGG + Intergenic
1044577639 8:93788388-93788410 TTGTATTTTCAGTAAAGACGGGG - Intronic
1045216480 8:100154114-100154136 CTGTATTTTCATATAATGCTTGG + Intergenic
1045300321 8:100905162-100905184 CAGGAGTTTGAGAAAAGCCTGGG + Intergenic
1045475565 8:102549565-102549587 CTGGAATTTGAGGAAAGCCTGGG - Intergenic
1045685676 8:104708924-104708946 CATTATTTTAAGAGAAGCCTGGG + Intronic
1045734339 8:105277441-105277463 TTGTATTTTTAGTAAAGACTGGG - Intronic
1046124419 8:109886300-109886322 TTGTATTTTCAGTAAAGACAGGG + Intergenic
1046452382 8:114411140-114411162 CAGTAATTTGAGACAAGCCTGGG - Intergenic
1046935802 8:119884228-119884250 CTGTATTTTCAGTAAAGATGGGG + Intronic
1047164178 8:122418396-122418418 CAGGATTTCCAGACAAGCCTGGG + Intergenic
1047326789 8:123846899-123846921 CTGTATTTTTAGAGAAGACGGGG - Intergenic
1047327429 8:123853325-123853347 CTGTATTTTTAGAGAAGACGGGG + Intronic
1047383363 8:124385177-124385199 TTGTATTTTTAGTAAAGACTGGG + Intergenic
1047515399 8:125550094-125550116 TTGTATTTTCAGTAAAGACGGGG + Intergenic
1047593263 8:126349750-126349772 TTGTATTTTCAGTAGAGACTGGG - Intergenic
1047616641 8:126568068-126568090 TTGTATTTTCAGTAGAGCCAGGG + Intergenic
1047985205 8:130226084-130226106 CTGGATTTTGAGACTAGCCTGGG - Intronic
1048334504 8:133492547-133492569 TTGTATTTTCAGTAAAGACAGGG - Intronic
1048914886 8:139173038-139173060 CAGGAGTTTCAGAACAGCCTTGG - Intergenic
1048952472 8:139507855-139507877 CTTGAGTTTCAGAAAAGACTTGG + Intergenic
1049333947 8:142072076-142072098 TTGTATTTTCAGTAGAGACTGGG - Intergenic
1051027284 9:12627915-12627937 CTGGAGTTTCAGACCAGCCTGGG - Intergenic
1051356045 9:16240462-16240484 CTGCATTCTCATAGAAGCCTAGG - Intronic
1051634784 9:19171808-19171830 TTGTATTTTTAGTAAAGACTGGG + Intergenic
1051646216 9:19271371-19271393 TTGTATTTTTAGTAAAGACTGGG + Intronic
1051869839 9:21725137-21725159 TTGTATTTTCAGTAGAGCCGGGG - Intergenic
1052061979 9:23971488-23971510 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1052389225 9:27858567-27858589 TTGTATTTTCAGTAAAGACAGGG + Intergenic
1052501327 9:29294730-29294752 TTGTATTTTCAGAAGAGACAGGG - Intergenic
1052631507 9:31047389-31047411 CTGTATTTTCAGTAGAGACGGGG - Intergenic
1053120337 9:35541617-35541639 TTGTATTTTCAGTAAAGACAGGG + Intronic
1053339241 9:37308806-37308828 TTGTATTTTTAGTAAAGACTGGG - Intronic
1053383349 9:37667236-37667258 TTGTATTTTCAGTAAAGACAGGG + Intronic
1053524673 9:38816562-38816584 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1053613646 9:39741764-39741786 ATGTATTTGCAGAAAAAACTAGG - Intergenic
1053871687 9:42499720-42499742 ATGTATTTGCAGAAAAAACTAGG - Intergenic
1054239868 9:62600633-62600655 ATGTATTTGCAGAAAAAACTAGG + Intergenic
1054554001 9:66635160-66635182 ATGTATTTGCAGAAAAAACTAGG + Intergenic
1055018985 9:71648954-71648976 TTGTATTTTCAGTAGAGACTGGG - Intergenic
1055521684 9:77087736-77087758 CTGTGCTATCAGTAAAGCCTGGG + Intergenic
1055890059 9:81114455-81114477 CTGTAGTTTAAGACCAGCCTCGG + Intergenic
1055957788 9:81790883-81790905 TTGTATTTTCAGAAAGGACGGGG - Intergenic
1056428728 9:86505512-86505534 TTGTATTTTCAGAAGAGACGGGG - Intergenic
1056448137 9:86686530-86686552 CTGTATTTTCAGTAGAGACGGGG - Intergenic
1056460235 9:86802193-86802215 TTGTATTTTCAGTAGAGACTGGG + Intergenic
1056511944 9:87314712-87314734 TTGTATTTTCAGTAAAGACGGGG + Intergenic
1056596143 9:88009323-88009345 CTGTATTTTTAGTAAAGACAGGG + Intergenic
1057149892 9:92787248-92787270 TTGTATTTTTAGCAGAGCCTGGG + Intergenic
1057440811 9:95081942-95081964 CTGTATTTTTAAAATAGCCAAGG - Intronic
1057602998 9:96475200-96475222 TTGTATTTTCAGTAGAGACTGGG - Intronic
1057607716 9:96512531-96512553 CAGAATTTTGAGAATAGCCTGGG - Intronic
1057609012 9:96524108-96524130 CTGTATTTTCAGTAGAGACGGGG + Intronic
1057828264 9:98387716-98387738 CAGGAGTTTGAGAAAAGCCTAGG + Intronic
1058141356 9:101359513-101359535 CTGTATTTTCAGTAGAGACAGGG - Intergenic
1058432335 9:104929903-104929925 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1058524964 9:105848596-105848618 CTGTATTTTTAGTAAAGACGGGG - Intergenic
1058581622 9:106465034-106465056 TTGTATTTTCAGGAAAGACGGGG - Intergenic
1058585716 9:106504388-106504410 TTGTATTTTTAGTAAAGACTGGG + Intergenic
1058755107 9:108076596-108076618 CTGTATTTTCAGTAGAGACGGGG + Intergenic
1059324101 9:113493138-113493160 CTGCCATTCCAGAAAAGCCTTGG - Intronic
1059876335 9:118639479-118639501 TTGTATTTTTAGAAAAGACAGGG + Intergenic
1060151534 9:121292103-121292125 CAGTAGTTTGAGAACAGCCTGGG - Intronic
1060170397 9:121456587-121456609 TTGTATTTTTAGTAAAGACTGGG + Intergenic
1060911460 9:127354467-127354489 TTTTATTTTCAGTAAAACCTGGG - Intronic
1061102530 9:128503213-128503235 CAGGAGTTTCAGACAAGCCTGGG - Intergenic
1061320792 9:129827963-129827985 CTGTATTTTCAGTAGAGACTGGG + Exonic
1061354097 9:130090921-130090943 CTTTATTTTCATAAATGCCTTGG + Exonic
1061568355 9:131459510-131459532 CTGGAGTTTGAGACAAGCCTGGG - Intronic
1061593713 9:131615246-131615268 TTGTATTTTCAGTAGAGCCGGGG + Intronic
1062000715 9:134214427-134214449 CTGTCTTTACACAAGAGCCTGGG + Intergenic
1062159837 9:135074250-135074272 CTGTATTTTCTGAGAAGCTAAGG - Intergenic
1202796733 9_KI270719v1_random:127356-127378 CAGGATTTTGAGAACAGCCTTGG - Intergenic
1185512115 X:671402-671424 TTGTATTTTTAGAAAAGACAGGG + Intergenic
1185701993 X:2237675-2237697 CTGTATTTTTAGTAGAGACTGGG + Intronic
1185706315 X:2269710-2269732 CTGTATTTTCAGTAGAGACGGGG + Intronic
1185908361 X:3958935-3958957 CAGGAGTTTGAGAAAAGCCTTGG + Intergenic
1185970203 X:4654225-4654247 CTGGAGTTTCAGATCAGCCTGGG + Intergenic
1185979721 X:4764131-4764153 TTGTATTTTCAGTAGAGACTGGG - Intergenic
1185983188 X:4802469-4802491 CTGGATTTTGAGACCAGCCTGGG + Intergenic
1186271322 X:7891306-7891328 TTGTATTTTTAGAAAAGCTGGGG + Intergenic
1186595296 X:10974859-10974881 CAGTATTTTCAGCAAAGTCCAGG - Intergenic
1186671982 X:11776746-11776768 TTGTATTTTCAGTAAAGACGAGG - Intergenic
1187009561 X:15265973-15265995 TTGTATTTTTAGTAAAGACTGGG + Intronic
1187350257 X:18507734-18507756 TTGTATTTTCAGTAGAGACTGGG + Intronic
1187817321 X:23246976-23246998 TTGTATTTTCAGTAGAGCCAAGG + Intergenic
1188947864 X:36330000-36330022 CTTTATTTTCAACAAAGCATTGG + Intronic
1189465200 X:41273135-41273157 CAGGATTTTGAGAACAGCCTGGG + Intergenic
1190365668 X:49691962-49691984 TTGTATTTTTAGCAGAGCCTGGG - Intronic
1191069405 X:56383993-56384015 TTGTATTTTCAGAAGAGACAGGG - Intergenic
1191182345 X:57577110-57577132 GTGTATTTTAAGAAATGTCTTGG + Intergenic
1191939335 X:66461311-66461333 TTGTATTTTTAGAAAAGACGGGG - Intergenic
1192235485 X:69292845-69292867 CTGTATTTTTAGTAAAGACGGGG - Intergenic
1193134648 X:77957003-77957025 CTGGAGTTTGAGACAAGCCTGGG - Intronic
1193665293 X:84309309-84309331 CTGTATTTTTAGCAGAGCCAGGG - Intergenic
1193972453 X:88072041-88072063 TTGTATTTTCAGTAAAGGCGAGG + Intergenic
1193978053 X:88147917-88147939 CTCAATTTTCAGGAAATCCTGGG - Intergenic
1194134463 X:90123172-90123194 TTGTATTTTTAGTAGAGCCTGGG - Intergenic
1194646607 X:96465503-96465525 TTGTATTTTTAGAAGAGACTGGG - Intergenic
1194705526 X:97171044-97171066 TTGTATTTTCAGCAGAGCCCGGG + Intronic
1194740966 X:97573831-97573853 CTGTATTTTCAGTACAGACAGGG + Intronic
1194900737 X:99507894-99507916 GTGAATATTCAGAAAAACCTTGG + Intergenic
1194968111 X:100312798-100312820 CTGAAGTTTCAGAGAAGTCTTGG + Intronic
1195047164 X:101064551-101064573 TTGTATTTTTAGAAGAGCCAGGG + Intergenic
1195366181 X:104127789-104127811 TTGTATTTTTAGTAAAGACTCGG - Intronic
1195373802 X:104205921-104205943 TTGTATTTTCAGTAAAGACGGGG - Intergenic
1196351252 X:114733233-114733255 TTGTATTTTCAGCAGAGACTGGG - Intronic
1196529683 X:116771138-116771160 CTGGAGTTTGAGAACAGCCTGGG + Intergenic
1196704111 X:118701773-118701795 TTGTATTTTTAGTAAAGACTGGG - Intergenic
1197065893 X:122233811-122233833 CTGTATTTTTAGAAGAGACGGGG - Intergenic
1197204201 X:123775725-123775747 TTGTATTTTCAGTAAAGACAGGG - Intergenic
1197357789 X:125457820-125457842 CAGGAGTTTCAGAACAGCCTGGG - Intergenic
1197647628 X:129035181-129035203 CTGTGTTTTCAGACACCCCTTGG - Intergenic
1197766739 X:130064263-130064285 TTGTATTTTCAGTAGAGCCAGGG - Intergenic
1197878314 X:131135455-131135477 CAGTAGTTTGAGAGAAGCCTAGG - Intergenic
1197980690 X:132216281-132216303 CTGTATTTACAGAAAATACGTGG - Intronic
1198339701 X:135701926-135701948 TTGTATTTTCAGTAAAGACGGGG + Intergenic
1198478204 X:137016342-137016364 CTGTGCTTTCACAAAACCCTGGG - Intergenic
1198713872 X:139535184-139535206 TTGTATTTTTAGTAAAGCCGGGG - Intronic
1199167753 X:144697390-144697412 CAGTAGTTTAAGACAAGCCTGGG + Intergenic
1199887213 X:152032067-152032089 CTGTGTTTTCTTAAAACCCTGGG - Intergenic
1200480241 Y:3693286-3693308 TTGTATTTTTAGTAGAGCCTGGG - Intergenic
1200747207 Y:6912656-6912678 TTGTATTTTCAGTAAAGACGCGG - Intronic
1200813544 Y:7508524-7508546 CTGTATTTTTAGTAGAGACTGGG + Intergenic
1201145118 Y:11060307-11060329 TTGTATTTTCAGTAAAGACGGGG + Intergenic
1201369514 Y:13246574-13246596 CTGTATTTTAATATAAACCTTGG - Intergenic
1201391271 Y:13500007-13500029 TTGTATTTTCAGTAGAGACTGGG - Intergenic
1201412959 Y:13719550-13719572 TTGTATTTTCAGTATAGACTGGG - Intergenic
1201608599 Y:15815492-15815514 CTGGAGTTTAAGAATAGCCTGGG - Intergenic
1201635875 Y:16122568-16122590 CTAAAGTTTCAGAAAAGTCTGGG - Intergenic