ID: 982695338

View in Genome Browser
Species Human (GRCh38)
Location 4:158592539-158592561
Sequence GCTCCCGTAGCCCAGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1356
Summary {0: 1, 1: 0, 2: 25, 3: 401, 4: 929}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982695338 Original CRISPR GCTCCCGTAGCCCAGGCTGG AGG (reversed) Intronic
900111818 1:1010089-1010111 GTTCTCGTCGCCCAGGCTGGAGG + Intergenic
900140032 1:1135964-1135986 GCTCCCGTGGGCAAGGCTGAGGG + Intergenic
900146988 1:1162742-1162764 GCTCCCATAGGCCGGGCGGGAGG - Intergenic
900534628 1:3170754-3170776 GCTCCCGTCACCAGGGCTGGAGG + Intronic
901105780 1:6755253-6755275 GCTCTTGTTGCCCAGGCTGCTGG - Intergenic
901284425 1:8065861-8065883 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
901305966 1:8233117-8233139 GCTCTCGTTGCCCAGGCTGGAGG + Intergenic
901476985 1:9496553-9496575 GCTCTTGTTGCCTAGGCTGGAGG - Intergenic
901596573 1:10390113-10390135 GCTCTTGTTGCCCAGTCTGGAGG - Intergenic
901887045 1:12230374-12230396 GCTCCCCAAGCACAGGCTCGGGG + Intronic
901888406 1:12240560-12240582 GCTTTTGTCGCCCAGGCTGGAGG - Intronic
901950367 1:12740582-12740604 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
902031253 1:13424129-13424151 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
902064207 1:13670835-13670857 GCTCTTGTTGCACAGGCTGGAGG - Intergenic
902125479 1:14206994-14207016 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
902212487 1:14913863-14913885 CCTCCTGGAGCCCAGGCAGGTGG + Intronic
902420867 1:16278802-16278824 GCTCTTGTTGCCGAGGCTGGAGG + Intronic
902736767 1:18406335-18406357 GCTCCTGTTGCCCAGGCTGAAGG - Intergenic
903207922 1:21796682-21796704 GCTCTTGTTGCTCAGGCTGGAGG - Intergenic
903344263 1:22674140-22674162 GCTCCCAATGCCCAGGCTGCGGG - Intergenic
903407304 1:23108565-23108587 GCTCCCATTGCCCAGGCTGGAGG - Intronic
903588066 1:24432160-24432182 GCTCTTGTTGCCTAGGCTGGAGG + Intronic
903949718 1:26989125-26989147 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
903994203 1:27295484-27295506 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
903998217 1:27321691-27321713 TCTCTTGTTGCCCAGGCTGGAGG - Intergenic
904107949 1:28101596-28101618 GCTCTTGTCGCCCAGGCTGGAGG - Intergenic
904122364 1:28208171-28208193 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
904133814 1:28295355-28295377 GCTCTTATTGCCCAGGCTGGAGG - Intergenic
904463186 1:30692583-30692605 GGTCCCCTAGCCCATCCTGGGGG + Intergenic
904553786 1:31343886-31343908 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
904744102 1:32700662-32700684 GCTCTTGTTGCTCAGGCTGGAGG - Intronic
904750390 1:32738203-32738225 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
904882669 1:33712471-33712493 GCTGCCGAGGCTCAGGCTGGAGG - Intronic
905049999 1:35042170-35042192 GGTTCCGTTGCCCAAGCTGGAGG - Intergenic
905080695 1:35317398-35317420 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
905622810 1:39463455-39463477 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
905696234 1:39975909-39975931 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
905709529 1:40089251-40089273 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
905935993 1:41824904-41824926 GCTCTTGTTGCACAGGCTGGAGG + Intronic
906065332 1:42976406-42976428 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
906285256 1:44582971-44582993 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
906310611 1:44751539-44751561 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
906578144 1:46909428-46909450 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
906639625 1:47433848-47433870 GCTCCCTTAGCCCAGGTGGGAGG - Intergenic
907055189 1:51359716-51359738 GCTCTTATTGCCCAGGCTGGAGG - Intronic
907448461 1:54526082-54526104 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
907554241 1:55331025-55331047 TCTCTTGTTGCCCAGGCTGGAGG - Intergenic
907896468 1:58697620-58697642 GCTCTTGTTGCCCAGGCTAGAGG + Intronic
908242872 1:62202715-62202737 GCTCTTGTCGCCCAGGCTGGAGG + Intronic
908372676 1:63499192-63499214 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
908660958 1:66434673-66434695 GCTCCTGTTGCCCAGGCTGGAGG + Intergenic
908722885 1:67145312-67145334 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
908841877 1:68288427-68288449 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
909618214 1:77636669-77636691 GCTCCCATCACCCAGGCTGAAGG - Intronic
909925128 1:81429924-81429946 GCTCTAGTTGCCCAGGCTGGAGG + Intronic
910194259 1:84624214-84624236 CCTCTTGTTGCCCAGGCTGGAGG + Intergenic
911390686 1:97237206-97237228 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
912163367 1:107012964-107012986 GATCTTGTTGCCCAGGCTGGAGG - Intergenic
912432723 1:109637759-109637781 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
912460168 1:109825190-109825212 GCTCCTGTTGCCTAGGCTGGAGG + Intergenic
912791870 1:112660310-112660332 GCTCTTATTGCCCAGGCTGGAGG + Intronic
912822818 1:112881457-112881479 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
912841055 1:113039408-113039430 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
912845734 1:113073289-113073311 TCTCCCGAAGCCCCGGCTGAAGG - Exonic
912854078 1:113151733-113151755 GCTCTTGTCGCCCAGGCTGGAGG - Intergenic
912877175 1:113371666-113371688 GCTCTTGTTGCCCAGGCGGGGGG - Intergenic
912910853 1:113758196-113758218 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
913225634 1:116695862-116695884 GCTCCTTTTGCCCAGACTGGAGG + Intronic
913533394 1:119749017-119749039 GCTACTGGAGCCAAGGCTGGGGG + Intronic
913539587 1:119805962-119805984 ACTCCCATCGCCCAGGCTGGAGG + Intronic
914695891 1:150079076-150079098 GCTCTCGTTGCCCAGGCTGGAGG - Intronic
914706111 1:150171245-150171267 GCTCTTGTTGTCCAGGCTGGAGG + Intergenic
914711487 1:150217905-150217927 GCTCTCATTGCCCAGGCTGGAGG - Intergenic
914805587 1:150989003-150989025 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
915148595 1:153810793-153810815 TCGCTCGTTGCCCAGGCTGGAGG + Intronic
915162769 1:153931834-153931856 GCTCTTGTTGCTCAGGCTGGAGG + Intronic
915381245 1:155442548-155442570 GCTCTTGTCGCCCAGGCTGGAGG - Intronic
915505040 1:156349490-156349512 GCTCTTGTCCCCCAGGCTGGAGG - Intronic
915902662 1:159857540-159857562 GCTCTTGTTGCCCAAGCTGGAGG - Intronic
916044420 1:160988410-160988432 ACTCTTGTCGCCCAGGCTGGAGG - Intergenic
916376474 1:164159567-164159589 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
916742863 1:167661597-167661619 CCTCCAGGAGCCCAGGATGGTGG - Intronic
916801753 1:168222653-168222675 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
916874190 1:168951195-168951217 GCTCCCATAGCCCCAGCTTGAGG - Intergenic
917061853 1:171049715-171049737 TCCTCTGTAGCCCAGGCTGGAGG + Intronic
917351480 1:174082714-174082736 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
917541565 1:175919675-175919697 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
917813229 1:178680708-178680730 GCTATTGTTGCCCAGGCTGGAGG - Intergenic
918262101 1:182805396-182805418 GCTCTTGTCGCCCAGGCTGGAGG - Intronic
918436642 1:184520924-184520946 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
919276262 1:195420478-195420500 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
919322855 1:196065192-196065214 GAGTCCGTCGCCCAGGCTGGAGG + Intergenic
919637688 1:200018871-200018893 CCTCTTGTTGCCCAGGCTGGAGG - Intergenic
919823316 1:201486416-201486438 ACTCCCAGTGCCCAGGCTGGTGG + Intronic
919941620 1:202290829-202290851 GCTCCTGTTGCCCAGGCTGGAGG - Intronic
920184897 1:204153324-204153346 GCTCATGTTGCCCAGGCTGCTGG + Intergenic
920240139 1:204540728-204540750 GCTCTTGTCCCCCAGGCTGGAGG - Intronic
920332774 1:205222823-205222845 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
920360162 1:205409803-205409825 GCGCTTGTTGCCCAGGCTGGAGG + Intronic
920397494 1:205657993-205658015 CCTCCCTTAGCTCAGGCAGGGGG + Exonic
920497604 1:206466671-206466693 ACTCTTGTTGCCCAGGCTGGGGG - Intergenic
920759468 1:208768620-208768642 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
920989849 1:210926228-210926250 GCTCTTGTTGTCCAGGCTGGAGG - Intronic
921223601 1:212994247-212994269 ACTCTTGTTGCCCAGGCTGGGGG - Exonic
921764281 1:218952312-218952334 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
922275917 1:224078269-224078291 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
922283330 1:224146031-224146053 GCTATTGTTGCCCAGGCTGGAGG - Intronic
922456819 1:225780410-225780432 GTTCTTGTTGCCCAGGCTGGAGG + Intronic
922596640 1:226818795-226818817 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
922659292 1:227415568-227415590 TCTCCCGCAGCCAAGGCTGATGG + Intergenic
922849610 1:228721691-228721713 GCTCTGGTTGCCCAAGCTGGAGG + Intergenic
923013776 1:230109795-230109817 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
923396351 1:233568905-233568927 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
923495101 1:234517759-234517781 CCTCCCCTAGCCCATGCCGGTGG + Intergenic
924092090 1:240511725-240511747 GCTCTTGTCGCCCAGGCTGCAGG - Intronic
924120746 1:240795149-240795171 GCTCTTGTTGTCCAGGCTGGAGG - Intronic
924239203 1:242025131-242025153 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
924263394 1:242254635-242254657 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
924285049 1:242477215-242477237 GCTCTTGTCACCCAGGCTGGAGG - Intronic
924516494 1:244770420-244770442 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1062813103 10:480257-480279 GACCCCGGAGCTCAGGCTGGTGG - Intronic
1063249038 10:4253842-4253864 GCTCCTGTCGCACACGCTGGTGG - Intergenic
1063344495 10:5298606-5298628 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1063701269 10:8387510-8387532 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1063827689 10:9916726-9916748 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1064173537 10:13054698-13054720 CCTCTTGTTGCCCAGGCTGGAGG + Intronic
1064455684 10:15485481-15485503 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1064664762 10:17639436-17639458 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1064794816 10:18999444-18999466 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1065085440 10:22170057-22170079 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1065188732 10:23192425-23192447 CCTCCCGGGGCCCTGGCTGGGGG - Exonic
1065487917 10:26252686-26252708 GCTCTTGTTGCCCAGGCTGCTGG + Intronic
1065551470 10:26872251-26872273 CCCTCTGTAGCCCAGGCTGGAGG + Intergenic
1065583625 10:27196165-27196187 TCTCTTGTTGCCCAGGCTGGAGG - Exonic
1065606952 10:27428041-27428063 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1066549570 10:36541330-36541352 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1066644047 10:37586809-37586831 ACACTCGTTGCCCAGGCTGGAGG - Intergenic
1067030252 10:42875053-42875075 GCACCAGTCTCCCAGGCTGGAGG + Intergenic
1067112668 10:43411191-43411213 GCTCTTGTTACCCAGGCTGGAGG - Intergenic
1067113267 10:43415916-43415938 GCTCTTGTTTCCCAGGCTGGAGG - Intergenic
1067129700 10:43551877-43551899 GCTCTTGTTGTCCAGGCTGGAGG + Intergenic
1067370331 10:45676536-45676558 GCTCTTGTTGCCCAGACTGGTGG - Intergenic
1067412225 10:46075344-46075366 ACTCTTGTCGCCCAGGCTGGAGG + Intergenic
1067656077 10:48192555-48192577 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1068068447 10:52164316-52164338 GCTCTGGTCGCCCAGGCTGGAGG - Intronic
1069006885 10:63327699-63327721 GCTCTTGTTCCCCAGGCTGGAGG + Intronic
1069359311 10:67623847-67623869 GCTCTTGTTGCCCAGGCTGAAGG + Intronic
1069441812 10:68435487-68435509 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1069483985 10:68809225-68809247 GCTCTTGTCGCCCAGGCTCGAGG + Intergenic
1069527371 10:69184500-69184522 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
1069558391 10:69412862-69412884 ACTCTTGTCGCCCAGGCTGGTGG + Intronic
1069920310 10:71812103-71812125 GCTGCCGAAACCCAGGCTGTGGG + Intronic
1069973588 10:72194773-72194795 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1070250597 10:74769691-74769713 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1070266763 10:74910263-74910285 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1070309836 10:75265231-75265253 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1070996246 10:80785571-80785593 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1071150809 10:82632068-82632090 GCTCTTGTTGCCCAGGTTGGAGG - Intronic
1071183089 10:83009700-83009722 GCTCTTGTCGCCCAGGCTGGAGG + Intergenic
1071888210 10:89973249-89973271 GTCCCTGTCGCCCAGGCTGGAGG - Intergenic
1072108496 10:92295903-92295925 GCTCTTGTTGCCCAGGCTGCTGG + Intronic
1072163785 10:92792409-92792431 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1072362279 10:94671244-94671266 ACTTCTGTTGCCCAGGCTGGAGG + Intergenic
1072500894 10:96016751-96016773 GCTCTTGCTGCCCAGGCTGGAGG + Intronic
1072659060 10:97351336-97351358 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1072910824 10:99499317-99499339 GCTCTTGTTGCCCAGGCTAGTGG + Intergenic
1073031248 10:100527850-100527872 GCTCTTGTTGCCCAGACTGGAGG + Intronic
1073037209 10:100572389-100572411 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1073103458 10:101019054-101019076 GCAGCCGCGGCCCAGGCTGGGGG - Exonic
1073311025 10:102541912-102541934 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1073403077 10:103274870-103274892 GCTCTTCTTGCCCAGGCTGGAGG - Intergenic
1073408258 10:103317787-103317809 GCTCTTGTTGTCCAGGCTGGAGG + Intronic
1073599478 10:104832683-104832705 ACTCTCGTTGCCGAGGCTGGAGG - Intronic
1073724536 10:106214485-106214507 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1073958362 10:108897805-108897827 GCTCTTGTTGGCCAGGCTGGAGG + Intergenic
1073966185 10:108992984-108993006 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1074465814 10:113680077-113680099 GCTCCCCTAGACCACGCTGGGGG - Intronic
1074540214 10:114358880-114358902 GCTCCTATTGCCCAGGCTGGAGG - Intronic
1074681417 10:115911348-115911370 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1075102406 10:119515721-119515743 GCTCCTGTGGGCCTGGCTGGAGG - Intronic
1075331309 10:121576152-121576174 GCTCTTGTTGCCCAGGTTGGAGG - Intronic
1075586053 10:123658983-123659005 GCTCCTGTCGCCCAGGCTGGAGG - Intergenic
1075703512 10:124484365-124484387 GCTCCCCTTTCCCAGGGTGGGGG + Intronic
1075726765 10:124614649-124614671 GCTTTCGTTGCCCAGGCTGGAGG + Intronic
1076378960 10:130012041-130012063 GCTCCAGGAGCCCAGGCTGGCGG - Intergenic
1076611762 10:131730375-131730397 GCTCCTGCAACCCAGGCTGTGGG - Intergenic
1076649377 10:131977234-131977256 GCTATTGTTGCCCAGGCTGGGGG - Intronic
1076657162 10:132032323-132032345 GCTCCCATCACACAGGCTGGAGG + Intergenic
1076758508 10:132587977-132587999 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
1076784902 10:132744997-132745019 TCTCCCGTGGCACAGGCTTGGGG + Intronic
1076880045 10:133235679-133235701 GCTGCTCTAGCCCAGGCTTGGGG - Intergenic
1076901510 10:133340854-133340876 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1077122902 11:918626-918648 GCTCTTGTCCCCCAGGCTGGAGG - Intergenic
1077291911 11:1800536-1800558 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1077448716 11:2620247-2620269 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1077878138 11:6324840-6324862 ACCCCTGTTGCCCAGGCTGGAGG - Intergenic
1078497190 11:11829815-11829837 GCTCTTGTTGTCCAGGCTGGAGG - Intergenic
1078553674 11:12300259-12300281 GCTCTTGTCGCCCAGGCTGGAGG - Intronic
1078569946 11:12449184-12449206 CTCCCCGTCGCCCAGGCTGGAGG + Intronic
1079064099 11:17274861-17274883 GCTCTTGTCGCCCAGGCTGGAGG + Intronic
1079387593 11:19994511-19994533 GCTCTTGTCGCCCAGGCTGGAGG - Intronic
1079922451 11:26449784-26449806 GCTGTTGTTGCCCAGGCTGGAGG + Intronic
1080154489 11:29092756-29092778 GCTTTAGTTGCCCAGGCTGGAGG - Intergenic
1080198816 11:29644259-29644281 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1080364732 11:31559871-31559893 GCTCTTGTTGCCCAGGCTGCTGG - Intronic
1080496586 11:32826892-32826914 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1080740587 11:35060249-35060271 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1080799510 11:35597352-35597374 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1081900092 11:46620121-46620143 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1081920530 11:46771440-46771462 ACTCCCGTCACCCAGGCTGGAGG + Intronic
1081972798 11:47211611-47211633 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1082033837 11:47627661-47627683 TCTCTTGTTGCCCAGGCTGGAGG + Intronic
1082092645 11:48102439-48102461 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1082094474 11:48117587-48117609 GCTCTCAAAACCCAGGCTGGAGG - Intronic
1082705313 11:56487580-56487602 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1083048338 11:59755700-59755722 GCTCCCCAAGTCGAGGCTGGAGG + Intronic
1083221154 11:61253461-61253483 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1083389621 11:62338066-62338088 GATGCCGTAGCCCACGGTGGCGG - Exonic
1083979992 11:66159402-66159424 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1084059114 11:66658056-66658078 GCTCTTGTTGCCCAGGCTGCTGG + Intronic
1084535613 11:69754728-69754750 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1085097100 11:73770077-73770099 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1085241993 11:75064605-75064627 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1085629665 11:78103593-78103615 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1085665266 11:78409550-78409572 GCTGTTGTTGCCCAGGCTGGAGG - Intronic
1086263726 11:84972988-84973010 GCTCTTTTTGCCCAGGCTGGAGG + Intronic
1087040346 11:93793149-93793171 GCTCTTGTTGCCCAGGCTAGAGG + Intronic
1087340056 11:96892943-96892965 GCTCTTATTGCCCAGGCTGGAGG - Intergenic
1088300825 11:108356501-108356523 GCTCTTGTCGCCCAGGCTGGAGG - Intronic
1088344131 11:108803559-108803581 GCTCTTGTTGCCCAGGCTAGAGG - Intronic
1089197330 11:116701834-116701856 TCCTCCCTAGCCCAGGCTGGGGG + Intergenic
1089247256 11:117131007-117131029 GCTTTTGTCGCCCAGGCTGGAGG - Intergenic
1089272742 11:117313465-117313487 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1089303903 11:117515067-117515089 GCTGCGATAGCCCAGGATGGTGG + Intronic
1089363876 11:117909344-117909366 GGGCCCACAGCCCAGGCTGGTGG - Intronic
1089621529 11:119725447-119725469 GCCTCCGTAGTCAAGGCTGGAGG - Intronic
1089756721 11:120692762-120692784 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1089912693 11:122118229-122118251 GCTCTTGTTACCCAGGCTGGAGG + Intergenic
1089983691 11:122793348-122793370 GCTCTTGTCGCCCAGGCTGAAGG - Intronic
1090127086 11:124097851-124097873 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1090229739 11:125092892-125092914 GCCCCCGTCCCCCTGGCTGGTGG - Intergenic
1090278250 11:125434652-125434674 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1090346953 11:126079243-126079265 CGTTCTGTAGCCCAGGCTGGAGG - Intergenic
1091161932 11:133431496-133431518 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1091227688 11:133967412-133967434 GCGCCTGTAGCCCGGGCGGGTGG - Intergenic
1091490540 12:928482-928504 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1091878486 12:3957254-3957276 GCTCTTGTTGCCCAGGATGGAGG - Intergenic
1092138284 12:6164976-6164998 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1092256961 12:6931680-6931702 GCTCTTGTTCCCCAGGCTGGAGG - Intronic
1092346106 12:7715762-7715784 GTTCTTGTTGCCCAGGCTGGAGG - Intronic
1092354728 12:7785210-7785232 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1092479612 12:8848093-8848115 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1092608940 12:10152058-10152080 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1093016695 12:14162393-14162415 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1093059097 12:14584110-14584132 GCTCTTGTCGCCCAGGCTGGAGG + Intergenic
1093296587 12:17399546-17399568 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1093296795 12:17401029-17401051 GCTCCCTAGTCCCAGGCTGGGGG + Intergenic
1093467430 12:19464617-19464639 GTTCTTGTTGCCCAGGCTGGAGG + Intronic
1093616341 12:21230361-21230383 GCTCTTGTTACCCAGGCTGGAGG + Intronic
1093727538 12:22532295-22532317 ACTCCCGTTGCCCAGGCTGGAGG - Intronic
1094127571 12:27039494-27039516 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1094192696 12:27712981-27713003 ACTCCCGTCACCCAGGCCGGAGG - Intronic
1094671925 12:32579077-32579099 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1095366059 12:41406823-41406845 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
1095615079 12:44179158-44179180 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1095949288 12:47773217-47773239 GCTCCCGCGGCTCCGGCTGGCGG + Exonic
1096095830 12:48934984-48935006 GGTCTTGTTGCCCAGGCTGGAGG - Intronic
1096290003 12:50334201-50334223 GATCTTGTTGCCCAGGCTGGAGG + Intronic
1096367854 12:51043915-51043937 GCTCTTGTTGCTCAGGCTGGAGG + Intergenic
1096430518 12:51539199-51539221 GCTCTTATTGCCCAGGCTGGAGG + Intergenic
1096476222 12:51910859-51910881 GCCCCAGAGGCCCAGGCTGGGGG - Intronic
1096655114 12:53084808-53084830 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1097168261 12:57097094-57097116 GCTCATCTGGCCCAGGCTGGGGG + Exonic
1097206866 12:57330004-57330026 GCTCTTATTGCCCAGGCTGGAGG + Intronic
1097271544 12:57777984-57778006 GCACTTGTTGCCCAGGCTGGAGG - Intronic
1098028017 12:66226272-66226294 GCTCTTGTCGCACAGGCTGGAGG + Intronic
1098263441 12:68694867-68694889 GCTCTTGTTGCCCAGGATGGAGG - Intronic
1098264259 12:68702874-68702896 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1098781694 12:74695338-74695360 ACTCTTGTAGCCCAAGCTGGAGG + Intergenic
1099603385 12:84770258-84770280 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1100369264 12:93951117-93951139 CCTCCTGTCACCCAGGCTGGAGG - Intergenic
1100668063 12:96777377-96777399 GCTCTTGTTGCCCAGGCTGCTGG + Intronic
1101123299 12:101605827-101605849 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1101146784 12:101848149-101848171 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1101894867 12:108748633-108748655 GCTCTTGTTGTCCAGGCTGGAGG - Intergenic
1102176706 12:110881100-110881122 ACTCCCTTTGCCCAGGGTGGAGG + Exonic
1102267077 12:111495273-111495295 GCTATTGTTGCCCAGGCTGGAGG - Intronic
1102923141 12:116807999-116808021 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1103088399 12:118079864-118079886 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1103154879 12:118675847-118675869 ACTCTTGTCGCCCAGGCTGGAGG - Intergenic
1103193872 12:119025475-119025497 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1103354416 12:120309147-120309169 ACTCTTGTCGCCCAGGCTGGAGG - Intronic
1103534486 12:121625484-121625506 GCTCTTGTCGCCCAGGCTGGAGG - Intergenic
1103687161 12:122741238-122741260 GCTCTTGCTGCCCAGGCTGGAGG + Intergenic
1103819018 12:123682512-123682534 GCTCTTGTTGCCTAGGCTGGAGG + Intronic
1104260929 12:127181463-127181485 CCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1104378662 12:128288089-128288111 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1104460576 12:128952498-128952520 GCTCTTGTTGCCCAGGCTGAAGG + Intronic
1104467164 12:128999840-128999862 GCTCTTGTCGCCCAGGCTGGAGG - Intergenic
1104512325 12:129392088-129392110 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1104872209 12:132007978-132008000 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1105033874 12:132904353-132904375 GTTTCTGTCGCCCAGGCTGGAGG - Intronic
1105391041 13:19978447-19978469 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1105695368 13:22883466-22883488 GCTCTTGTTGCCCAGGCAGGAGG + Intergenic
1106300146 13:28456761-28456783 CATCCTGTTGCCCAGGCTGGAGG - Intronic
1106457593 13:29940591-29940613 GCTCTTGTAGCCCATGCTGGAGG - Intergenic
1106530750 13:30589036-30589058 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1106726156 13:32487889-32487911 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1107015782 13:35706795-35706817 GCTCCCATGCCCCAGGGTGGGGG - Intergenic
1107143367 13:37029490-37029512 GCTCTTATCGCCCAGGCTGGAGG - Intronic
1107436220 13:40382795-40382817 GCTCTTGTCGTCCAGGCTGGAGG + Intergenic
1107452903 13:40527659-40527681 GCTCTTGCTGCCCAGGCTGGGGG - Intergenic
1107508440 13:41058938-41058960 GCTCTGTTAACCCAGGCTGGAGG - Intronic
1107706734 13:43115507-43115529 GCTCTTGTTGACCAGGCTGGAGG + Intergenic
1107735660 13:43396410-43396432 GCTCTTGTAGCCCAGGCTGGAGG + Intronic
1108067117 13:46589631-46589653 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1108580649 13:51825665-51825687 AGTCCTGTTGCCCAGGCTGGAGG + Intergenic
1108594757 13:51940043-51940065 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1109121450 13:58462486-58462508 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1109296634 13:60541198-60541220 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1109434858 13:62285604-62285626 GCTCCTGTTGCCCAGGCTGAAGG + Intergenic
1109748977 13:66665137-66665159 GCTCTTGTCGCCCAGGCTGGAGG + Intronic
1109992249 13:70073856-70073878 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1110104796 13:71658515-71658537 GCTCTTATTGCCCAGGCTGGAGG - Intronic
1110364558 13:74667397-74667419 GCTCAGGTGGCCCAGGCAGGAGG - Intergenic
1110613230 13:77512112-77512134 GCTCTTGTAGGCCAGGCTGGAGG - Intergenic
1110670599 13:78172857-78172879 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1110705883 13:78602014-78602036 GCTGCCGCACCCCGGGCTGGTGG - Exonic
1110914135 13:81000084-81000106 GCTCCTGTTGCCCAGGTTGGAGG + Intergenic
1111936574 13:94564055-94564077 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1111944981 13:94655540-94655562 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1111967749 13:94878060-94878082 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1112543055 13:100336227-100336249 GCTCTTGCTGCCCAGGCTGGAGG - Intronic
1112767480 13:102761035-102761057 GCTGTTGTTGCCCAGGCTGGAGG - Intergenic
1113050135 13:106201769-106201791 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1113474648 13:110571855-110571877 GGTCCCATCCCCCAGGCTGGGGG - Intergenic
1113486188 13:110654011-110654033 TCTCCCAGAGCCCAGGCCGGAGG + Intronic
1113832178 13:113304687-113304709 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1114291421 14:21291791-21291813 GCTTTTGTTGCCCAGGCTGGAGG + Intronic
1114338306 14:21715671-21715693 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1114370472 14:22081996-22082018 GTTCTTGTTGCCCAGGCTGGAGG + Intergenic
1114424364 14:22610088-22610110 GCTATTGTTGCCCAGGCTGGAGG + Intronic
1114439339 14:22733539-22733561 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1114631934 14:24164741-24164763 GCTCCAGTGGGCCAGGCTTGGGG - Exonic
1114904411 14:27107889-27107911 GCTCTCATTGCCCAGGCTGGAGG - Intergenic
1114979391 14:28144161-28144183 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1115264996 14:31492102-31492124 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
1115322265 14:32095443-32095465 GCTCTTGTTTCCCAGGCTGGAGG + Intronic
1115647362 14:35378309-35378331 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1115864205 14:37725381-37725403 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1116361598 14:44005127-44005149 ACTCCTGTTGCCCAGGCTGCAGG - Intergenic
1116637560 14:47416774-47416796 GCTCCAGTAGGCCAAGGTGGGGG - Intronic
1116714324 14:48408372-48408394 TCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1117180334 14:53185116-53185138 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1117359355 14:54958157-54958179 GCTCTTGTTGCCCAAGCTGGAGG + Intronic
1117705921 14:58468076-58468098 GCTCTTGTCGCCCAGTCTGGAGG + Intronic
1118081608 14:62367651-62367673 GCTCTTGTTGCCCAGACTGGAGG - Intergenic
1118250575 14:64156489-64156511 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1118294086 14:64553002-64553024 ACTCCTGTTGCCCAGGCTGGTGG + Intronic
1118319308 14:64743767-64743789 GCTCCATGAGCCCAGGCTTGAGG - Exonic
1118654351 14:67931533-67931555 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1118832972 14:69452360-69452382 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1119096999 14:71842432-71842454 GCTCTTGTCGCCCAGTCTGGAGG + Intergenic
1119253846 14:73181402-73181424 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1119265786 14:73262687-73262709 CCTCCCCTGGCCCAGGCTGTTGG - Exonic
1119267615 14:73273012-73273034 ACTCTTGTTGCCCAGGCTGGAGG + Exonic
1119307735 14:73621178-73621200 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1119393539 14:74308545-74308567 GCTCTTGTTGCTCAGGCTGGAGG + Intronic
1119810493 14:77513860-77513882 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1120192020 14:81448135-81448157 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1120472172 14:84939212-84939234 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1120759489 14:88272985-88273007 GCTCCTGTAGCCCATCCAGGTGG + Intronic
1120962911 14:90141488-90141510 GCTCTCGTTGCCCAGGCTGGAGG + Intronic
1121140357 14:91536416-91536438 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1121379666 14:93452411-93452433 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1121418429 14:93795367-93795389 GCTCTTGTTGCCCAGGGTGGAGG - Intergenic
1121464863 14:94109267-94109289 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1121629877 14:95414183-95414205 GACCCCAAAGCCCAGGCTGGAGG - Intronic
1121946301 14:98125858-98125880 GCTCCCATTCCCCAGTCTGGAGG + Intergenic
1122512027 14:102276756-102276778 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1122516082 14:102309743-102309765 TCTCCTGTTGCCCAGGCTGGAGG - Intergenic
1122536801 14:102470670-102470692 GCTCTTGTTGCCCAGACTGGAGG + Intronic
1122571528 14:102706079-102706101 ACTCTCCTTGCCCAGGCTGGAGG - Intronic
1122584757 14:102797767-102797789 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1122624612 14:103077993-103078015 GCTCACATGGCCCAGCCTGGTGG + Intergenic
1122735129 14:103834621-103834643 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1123035354 14:105469696-105469718 GCTGCCCTGGGCCAGGCTGGGGG + Intronic
1123437907 15:20269105-20269127 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1123540707 15:21287287-21287309 TCACTCGTTGCCCAGGCTGGAGG + Intergenic
1123673133 15:22680531-22680553 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1123775294 15:23573636-23573658 GCTCTTGTTGTCCAGGCTGGAGG + Intronic
1123894917 15:24818989-24819011 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1124325188 15:28753824-28753846 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1124390051 15:29246668-29246690 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1124646445 15:31440732-31440754 GCTGCCAGAGCCCAGGCTTGGGG - Intergenic
1125656186 15:41359662-41359684 GCTCTTGTTGCCCAGACTGGAGG + Intronic
1125692621 15:41608726-41608748 GCTTTTGTCGCCCAGGCTGGTGG + Intergenic
1125933210 15:43614461-43614483 GATCCCACAGCACAGGCTGGTGG + Exonic
1125946308 15:43713923-43713945 GATCCCACAGCACAGGCTGGTGG + Intergenic
1126110786 15:45173585-45173607 CCTCCCTGAGCCCAGCCTGGAGG - Exonic
1126648457 15:50898264-50898286 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1126669294 15:51101586-51101608 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1126940345 15:53759579-53759601 GCTGCCGGGTCCCAGGCTGGTGG - Intronic
1127084454 15:55411886-55411908 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1127085972 15:55424893-55424915 GCTCTTGTTGCCCAGGCTGCTGG + Intronic
1127674642 15:61228296-61228318 GAGCCCGGCGCCCAGGCTGGCGG - Intronic
1127820238 15:62648578-62648600 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1128475110 15:67990790-67990812 GCTCTTGTCGCCCAGGCTTGGGG - Intergenic
1128876500 15:71205904-71205926 GCTGTTGTCGCCCAGGCTGGAGG + Intronic
1128977749 15:72165899-72165921 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1129468824 15:75738882-75738904 TCTTCCGCGGCCCAGGCTGGGGG + Intergenic
1129517339 15:76164827-76164849 GCTCCCTTCTCCCTGGCTGGCGG + Intronic
1129739162 15:77981634-77981656 CCTCCCGTGGCCCAGGCTGGGGG + Intergenic
1129846796 15:78771555-78771577 CCTCCCGTGGCCCAGGCGGGGGG - Intronic
1129899719 15:79137444-79137466 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1129921410 15:79322289-79322311 GGTCGCGTAGCCCAGGGTGGAGG + Exonic
1130385913 15:83412089-83412111 TCTCGTGTTGCCCAGGCTGGAGG + Intergenic
1130667204 15:85879790-85879812 GCTCTAGTGGCACAGGCTGGAGG - Intergenic
1131074657 15:89487355-89487377 GCTCTGCTGGCCCAGGCTGGAGG + Intronic
1131095242 15:89650424-89650446 GCTCTCGTTGCCCAAGCTGGAGG + Intronic
1131387237 15:92017822-92017844 GCTCCAGCAGACCAGGGTGGAGG + Intronic
1131673529 15:94647775-94647797 GCTCTCGTTGCCCAAGCTGGAGG + Intergenic
1131704337 15:94976415-94976437 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1132052298 15:98617017-98617039 GGTTCTGTTGCCCAGGCTGGAGG - Intergenic
1132275421 15:100559187-100559209 GGGCCCGTGGCCCAGGCTGTGGG + Intergenic
1202949019 15_KI270727v1_random:14429-14451 TCACTCGTTGCCCAGGCTGGAGG + Intergenic
1132685403 16:1159956-1159978 GCTCCAGGAGCCCGGCCTGGTGG - Intronic
1132768814 16:1549457-1549479 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1132773541 16:1578742-1578764 GGCTCCGTTGCCCAGGCTGGAGG + Intronic
1132790589 16:1684708-1684730 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
1132853043 16:2033376-2033398 GCTCCCGGAGCCCGGGCAGGTGG - Intronic
1133015838 16:2939421-2939443 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
1133192774 16:4146735-4146757 GCTCCTGTCACCCAGGCTGGAGG + Intergenic
1133243473 16:4430528-4430550 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1133274880 16:4632045-4632067 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1133298562 16:4767639-4767661 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1133505612 16:6409379-6409401 GCTCCCGTTGCCCTGGCTGGAGG - Intronic
1133812277 16:9169988-9170010 GCTCTTGTTGCCCAGGCTGTTGG + Intergenic
1133987523 16:10679862-10679884 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1134034562 16:11019734-11019756 GCTCTTGTCACCCAGGCTGGAGG - Intronic
1134038879 16:11052757-11052779 GATGCTGTAGCCCTGGCTGGGGG - Intronic
1134135742 16:11675290-11675312 GCTCCTGTCGCCCAGGCTGGAGG + Intronic
1134138215 16:11694478-11694500 GCTCCAGTTGCACAGGCTAGAGG + Intronic
1134282798 16:12832858-12832880 TTTTCTGTAGCCCAGGCTGGAGG + Intergenic
1134618132 16:15667662-15667684 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1135009835 16:18865693-18865715 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1135016876 16:18930987-18931009 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1135028676 16:19018881-19018903 GCTCTTGTTGCCCAGGCCGGAGG + Intronic
1135100820 16:19603762-19603784 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1135271164 16:21071073-21071095 ACTCCTGTTGCCCAGGCTGGAGG + Intronic
1135287804 16:21209197-21209219 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1135322511 16:21506833-21506855 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1135493873 16:22934363-22934385 GCTCTTGTCGCCCAGGCTGGAGG - Intergenic
1135528137 16:23229580-23229602 ACTCTTGTTGCCCAGGCTGGTGG + Intergenic
1135663100 16:24313775-24313797 GGTTCTGTCGCCCAGGCTGGAGG + Intronic
1135857427 16:26024697-26024719 GCTTTTGTCGCCCAGGCTGGAGG - Intronic
1136313536 16:29433328-29433350 GCTTTTGTTGCCCAGGCTGGAGG + Intergenic
1136326979 16:29535095-29535117 GCTTTTGTTGCCCAGGCTGGAGG + Intergenic
1136333990 16:29599971-29599993 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1136405545 16:30044338-30044360 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1136441670 16:30275080-30275102 GCTTTTGTTGCCCAGGCTGGAGG + Intergenic
1136846667 16:33581747-33581769 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1137044403 16:35642460-35642482 GTTCTTGTAGGCCAGGCTGGAGG + Intergenic
1137248225 16:46722740-46722762 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1137333213 16:47521620-47521642 GCTCTTGTTTCCCAGGCTGGAGG - Intronic
1137401956 16:48161023-48161045 TCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1137659445 16:50191884-50191906 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1137737145 16:50733277-50733299 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1137800419 16:51257700-51257722 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1138092065 16:54182904-54182926 CCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1138625310 16:58246971-58246993 ACTCTTGTCGCCCAGGCTGGAGG - Intronic
1138729218 16:59176304-59176326 GCTCTTGTTGCCCAGGTTGGAGG - Intergenic
1138960905 16:62028095-62028117 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1139006091 16:62573068-62573090 GCTCTTGTTGCCCAAGCTGGAGG - Intergenic
1139154990 16:64430646-64430668 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1139602713 16:67996391-67996413 GCTCCTGTTGCCCAGGCTGGAGG + Intronic
1139647653 16:68343169-68343191 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1139679229 16:68547866-68547888 GCTCTTGTTGCCCAGGCTAGAGG + Intronic
1139756129 16:69145107-69145129 GCTTTTGTCGCCCAGGCTGGAGG - Intronic
1139827476 16:69768575-69768597 GCTCTTGTTGCCCAGGCTAGAGG - Intronic
1140098350 16:71894291-71894313 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1140309726 16:73837669-73837691 GCTCTTGTTGCCCAGGCTAGAGG + Intergenic
1140447593 16:75043820-75043842 GTTCTTGTTGCCCAGGCTGGAGG + Intronic
1140556437 16:75926803-75926825 GCTCTTGTTGTCCAGGCTGGAGG - Intergenic
1140747996 16:77998044-77998066 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1140864351 16:79046962-79046984 GGTCAGGTAGCTCAGGCTGGGGG - Intronic
1141447844 16:84073971-84073993 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
1142162392 16:88564995-88565017 GCTATTGTCGCCCAGGCTGGAGG + Intergenic
1142219452 16:88846547-88846569 GCTGTTGTCGCCCAGGCTGGAGG + Intronic
1203108375 16_KI270728v1_random:1430402-1430424 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1203140581 16_KI270728v1_random:1763028-1763050 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1142560523 17:806495-806517 GGGCCTGTAGCCCTGGCTGGAGG - Intronic
1142812567 17:2402050-2402072 GCGCCCGCAGCCCAGACCGGGGG + Intergenic
1142886710 17:2917301-2917323 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1143000526 17:3792152-3792174 GGCCCTGTTGCCCAGGCTGGAGG + Intronic
1143346674 17:6254649-6254671 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1143388369 17:6545556-6545578 GCTGCTGAAGCCCAGGCTGCTGG - Intronic
1143627185 17:8117385-8117407 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1143695934 17:8618279-8618301 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1143799204 17:9364561-9364583 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1143810376 17:9466921-9466943 GCTCTTGTCCCCCAGGCTGGAGG + Intronic
1143924906 17:10361071-10361093 GCTCCAGTATCACAGACTGGGGG - Intronic
1144044806 17:11445858-11445880 CCTTCTGTCGCCCAGGCTGGAGG + Intronic
1144496345 17:15748645-15748667 GCTCTTGTCGCCCAGGCTGGAGG + Intronic
1144547583 17:16212231-16212253 GCTCTTGTCACCCAGGCTGGAGG - Intronic
1145088370 17:19963861-19963883 ACTCCCGTTGCTCAGGCTGGAGG - Intronic
1145940799 17:28742518-28742540 GGTTCTGTCGCCCAGGCTGGAGG - Exonic
1146169358 17:30621195-30621217 GCTTCCGTGGGCCTGGCTGGGGG + Intergenic
1146170204 17:30626254-30626276 GCTTCCGTGGGCCTGGCTGGGGG - Intergenic
1146183146 17:30709712-30709734 TCTCCCGGAGCCGGGGCTGGGGG - Intergenic
1146340970 17:32019882-32019904 TCTCTTGTTGCCCAGGCTGGAGG + Intronic
1146343656 17:32042283-32042305 GCTTCCGTGGGCCTGGCTGGGGG - Intronic
1146940692 17:36842458-36842480 GCCCCAGGAGCCCAGCCTGGAGG + Intergenic
1147021060 17:37533618-37533640 ACTCCTGTTGCCCAGGCTGGAGG + Intronic
1147217406 17:38908730-38908752 GTTCCTGCAGCCCGGGCTGGGGG - Intronic
1147473489 17:40686729-40686751 GCTCTTGTTGGCCAGGCTGGAGG + Intergenic
1148199994 17:45743892-45743914 GCTCCTGGAGCCCAGACTGAGGG + Intergenic
1148583268 17:48758480-48758502 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1148612661 17:48974701-48974723 GCTCTTGTCCCCCAGGCTGGAGG - Intergenic
1148612833 17:48975846-48975868 GCTCTTATTGCCCAGGCTGGAGG - Intergenic
1148712214 17:49690068-49690090 GCTCCTGTTGCCCTGGCTGGAGG - Intergenic
1148884446 17:50761635-50761657 GCTTTTGTCGCCCAGGCTGGAGG + Intergenic
1148932485 17:51138307-51138329 GCTTTTGTTGCCCAGGCTGGAGG - Intergenic
1148947337 17:51275162-51275184 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
1149442892 17:56690110-56690132 GCCACCGTGGCACAGGCTGGAGG + Intergenic
1149493385 17:57100994-57101016 GCTCTCGTTGTCCAGGCTGGAGG - Intronic
1149589191 17:57815979-57816001 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1149835113 17:59905535-59905557 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1149911926 17:60574532-60574554 ACTCTTGTCGCCCAGGCTGGAGG - Intronic
1149937317 17:60820977-60820999 GCTCTTGTCGCCCAGGCTGGAGG + Intronic
1150383986 17:64743047-64743069 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1150649006 17:66997782-66997804 ACTCCCATTGCCCAGGCTGGAGG - Intronic
1150808488 17:68337648-68337670 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1151287334 17:73122402-73122424 GCTTCAGGAGGCCAGGCTGGCGG - Intergenic
1151501843 17:74495035-74495057 ACTCCTGAAGCCCAGGCTGAGGG + Intergenic
1151613269 17:75190901-75190923 TCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1151649166 17:75455443-75455465 GCTCTTGTCGCCTAGGCTGGAGG - Intronic
1151909585 17:77073248-77073270 GCTCTTGTTACCCAGGCTGGAGG - Intergenic
1151944868 17:77314134-77314156 ACTCCCTTTGCCCAGGCTGGAGG - Intronic
1152505336 17:80746127-80746149 GCTCTTGTCACCCAGGCTGGAGG - Intronic
1152677544 17:81649289-81649311 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1152700968 17:81819620-81819642 GCTCCCGCAGCCCAGGGGAGAGG + Intergenic
1152828382 17:82481695-82481717 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
1152831852 17:82502147-82502169 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1152883729 17:82835453-82835475 GGTCTTGTTGCCCAGGCTGGAGG + Intronic
1153007224 18:508174-508196 GCTCTTGTTACCCAGGCTGGAGG + Intergenic
1153291508 18:3506202-3506224 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
1153321877 18:3781382-3781404 GCTCCTGTTGCCCAGGCTGGAGG + Intronic
1153514230 18:5890492-5890514 GCTCCCGGAGTCCCGCCTGGTGG + Exonic
1153708145 18:7768677-7768699 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1153869088 18:9300014-9300036 GCCTCTGTTGCCCAGGCTGGAGG + Intergenic
1153879001 18:9404312-9404334 ACTCTTGTGGCCCAGGCTGGAGG - Intergenic
1154124689 18:11679834-11679856 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1154211570 18:12383577-12383599 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1154240270 18:12647009-12647031 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1154954193 18:21239670-21239692 GTTCTTGTTGCCCAGGCTGGGGG + Intergenic
1155148498 18:23103908-23103930 GCTCTTGTTGCCTAGGCTGGGGG + Intergenic
1155200063 18:23509590-23509612 GCTCTTGTTGCCCAGGCTGGTGG + Intronic
1155345893 18:24856149-24856171 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1155869013 18:31002665-31002687 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1155959987 18:31986052-31986074 GTTCTTGTTGCCCAGGCTGGAGG - Intergenic
1156285153 18:35686033-35686055 ACTCCTGTTGCCCAGGCTAGAGG - Intronic
1157236388 18:45968521-45968543 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1157450402 18:47782264-47782286 GCTCTTGATGCCCAGGCTGGAGG - Intergenic
1158151425 18:54377059-54377081 GCTTTTGTTGCCCAGGCTGGAGG + Intronic
1158454297 18:57592974-57592996 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1159049116 18:63401285-63401307 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1159167620 18:64723188-64723210 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1159579650 18:70220550-70220572 GCTCTTGTTGCCTAGGCTGGAGG - Intergenic
1159680023 18:71338083-71338105 ACTCTTGTTGCCCAGGCTGGTGG + Intergenic
1160025101 18:75209766-75209788 CCTCCCGCTCCCCAGGCTGGTGG + Intergenic
1160188490 18:76695314-76695336 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1160769376 19:823407-823429 CCTTCTGTCGCCCAGGCTGGAGG - Intergenic
1160960957 19:1720605-1720627 TCTCTTGCAGCCCAGGCTGGGGG + Intergenic
1161095833 19:2390055-2390077 GCTGCCCTAGGCCAGGCGGGTGG + Intronic
1161103458 19:2432574-2432596 GCCCCCATCGCCCTGGCTGGTGG + Intronic
1161469088 19:4447511-4447533 GCCCCCGGGGCCCAGGCTGGGGG - Intronic
1161510998 19:4670829-4670851 CCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1161527240 19:4764017-4764039 TCTCCCCTTGCCCAGGCTGCAGG + Intergenic
1161531186 19:4790987-4791009 GCTCTTGTTGCCTAGGCTGGAGG - Intergenic
1161542410 19:4860012-4860034 TCTCCTGTAGCCCAGTGTGGTGG - Exonic
1161566111 19:5003774-5003796 ACTCTCGTCACCCAGGCTGGAGG - Intronic
1161797349 19:6394705-6394727 GCTCTTGTTGCCCAGACTGGAGG - Intergenic
1161836225 19:6648915-6648937 ACCCCTGTTGCCCAGGCTGGAGG + Intergenic
1162024517 19:7886331-7886353 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1162277894 19:9672810-9672832 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1162314528 19:9930004-9930026 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1162371541 19:10282978-10283000 CCTTCTGTCGCCCAGGCTGGAGG - Intronic
1162389762 19:10382335-10382357 GCTCTTGTTGCCCAGGCTGAAGG - Intergenic
1162417904 19:10549154-10549176 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1162425474 19:10592896-10592918 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1162446956 19:10729323-10729345 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1162510819 19:11117169-11117191 GCTCTCGTTTCCCAGGCTGGAGG + Intronic
1162521736 19:11184842-11184864 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1162636380 19:11970896-11970918 ACTCTCCTTGCCCAGGCTGGAGG - Intronic
1162651455 19:12091988-12092010 GCTCTTGTCGCCCAGGCTGAAGG - Intergenic
1162721916 19:12667624-12667646 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1162814487 19:13185416-13185438 GCTCTTGTTGCCCAGGCTGGCGG - Intergenic
1162816673 19:13199665-13199687 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1162874085 19:13607930-13607952 TCTCTTGTTGCCCAGGCTGGAGG - Intronic
1162975648 19:14206062-14206084 TCTCCCGGAGCCGGGGCTGGGGG + Exonic
1163074656 19:14879292-14879314 GCTCTTGTTGCCCAGACTGGAGG + Intergenic
1163086502 19:14984298-14984320 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1163280069 19:16310646-16310668 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1163367848 19:16886014-16886036 GCTCTTGTTGCCCAGGCTGAAGG - Intergenic
1163542565 19:17919639-17919661 GCTCTTGTTGACCAGGCTGGAGG - Intergenic
1163588784 19:18178707-18178729 GCTCTTGTTGCCCAGGCTGAAGG + Intergenic
1163593459 19:18206982-18207004 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1163756614 19:19110308-19110330 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
1163763938 19:19151991-19152013 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1163887777 19:19983160-19983182 GCTCTTGTTGCCCATGCTGGAGG - Intergenic
1163973165 19:20820294-20820316 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1163997331 19:21063438-21063460 GCTTCTGTTGCCCAGGCTGGAGG + Intergenic
1164019139 19:21281975-21281997 TCTCTTGTTGCCCAGGCTGGAGG + Intronic
1164162453 19:22636665-22636687 GCTCCTATTGCCCAGGCTGGAGG + Intronic
1164166676 19:22684342-22684364 GCTCCTGTCACCCAGCCTGGAGG + Intergenic
1164184556 19:22851817-22851839 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1164197984 19:22989016-22989038 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1164241030 19:23389296-23389318 GGTCCAGAACCCCAGGCTGGTGG + Intronic
1164939081 19:32237890-32237912 GGTTCTGTCGCCCAGGCTGGAGG + Intergenic
1165033884 19:33018996-33019018 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1165054524 19:33165866-33165888 GCTCTTGTCACCCAGGCTGGAGG - Intronic
1165379168 19:35465954-35465976 GCTCTTGTTGCCCAGGATGGAGG + Intergenic
1165507418 19:36243064-36243086 GCTCTTGTCCCCCAGGCTGGAGG + Intronic
1165543725 19:36515902-36515924 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1165648536 19:37466595-37466617 GCTCTCGTTGCCCAGGCTGCTGG - Intronic
1165750179 19:38254824-38254846 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1165940502 19:39412792-39412814 GACCCCGGCGCCCAGGCTGGAGG + Exonic
1166059819 19:40319235-40319257 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1166206045 19:41270013-41270035 GCTCTTGTTCCCCAGGCTGGAGG + Intronic
1166222532 19:41374948-41374970 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
1166641995 19:44501115-44501137 GCTCTTGTCGCCCAGGCTGGAGG + Intergenic
1166732031 19:45064522-45064544 GGTCCCGTAGCCGTGGCCGGCGG + Exonic
1166793513 19:45412189-45412211 GCTTCTGTTGTCCAGGCTGGAGG + Intronic
1166852403 19:45766981-45767003 GCTCCCGTTCACCAGGATGGAGG + Exonic
1166956545 19:46469139-46469161 ACTCTCGTCACCCAGGCTGGAGG + Intronic
1166978077 19:46616771-46616793 CCTCCCGTAGCTCAGTTTGGTGG - Intergenic
1167338025 19:48898483-48898505 TCTCCCGGATCCCAGGCAGGTGG - Intronic
1167710173 19:51105520-51105542 ACTACAGTAGTCCAGGCTGGAGG - Intronic
1167846294 19:52167437-52167459 GTTCTTGTTGCCCAGGCTGGAGG - Intronic
1168038820 19:53741787-53741809 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1168039005 19:53743174-53743196 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1168042217 19:53767780-53767802 GTTCTTGTCGCCCAGGCTGGAGG - Intergenic
1168092845 19:54096911-54096933 GCTACCGAAGGCCAGACTGGGGG - Exonic
1168138198 19:54365747-54365769 GCTGTTGTTGCCCAGGCTGGAGG - Intronic
1168531583 19:57134057-57134079 TCACCTGTTGCCCAGGCTGGAGG - Intergenic
925160077 2:1677536-1677558 TCTCCCCTTGCCCAGGGTGGAGG - Intronic
925342256 2:3145782-3145804 GCTCCTCCAGCCCAGGCTGGCGG - Intergenic
925751242 2:7091756-7091778 TCTCGGGGAGCCCAGGCTGGAGG - Intergenic
926273258 2:11383902-11383924 GCTCTTGATGCCCAGGCTGGAGG + Intergenic
926273690 2:11387497-11387519 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
926346216 2:11948197-11948219 GCTCTTGTCGCCCTGGCTGGAGG + Intergenic
927485000 2:23482439-23482461 ACTCCCAGAGCACAGGCTGGGGG - Intronic
927508149 2:23627938-23627960 GCTCTTGTCACCCAGGCTGGAGG + Intronic
927533508 2:23834192-23834214 CATTCCGTTGCCCAGGCTGGAGG + Intronic
927654544 2:24934470-24934492 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
927738380 2:25544101-25544123 GCACCCGCAGCCCAGCGTGGGGG + Intronic
927791109 2:26010324-26010346 GCTCTTATTGCCCAGGCTGGAGG - Intergenic
927867146 2:26596712-26596734 GCTCTTTTTGCCCAGGCTGGAGG - Intronic
928043207 2:27899505-27899527 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
928087535 2:28355349-28355371 ACTCCAGTAGCCCTGGCTGGAGG + Intergenic
928517181 2:32054544-32054566 GCTCTTATTGCCCAGGCTGGAGG - Intergenic
928790020 2:34939205-34939227 GTTCTTGTTGCCCAGGCTGGAGG + Intergenic
928925733 2:36577288-36577310 GCTTTTGTTGCCCAGGCTGGAGG + Intronic
929509234 2:42553700-42553722 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
929707525 2:44229147-44229169 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
929814926 2:45223079-45223101 GCTCTTGTTGCCCAGGTTGGAGG - Intergenic
929826868 2:45315733-45315755 GCTCCTTCAGCCCAGGTTGGAGG - Intergenic
929832281 2:45356753-45356775 GCAGCAGTAGCCCAGGCAGGTGG - Intergenic
930042320 2:47136176-47136198 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
930320214 2:49844382-49844404 GCTCTTGTGGCCCAGGCTGGAGG - Intergenic
930666732 2:54106612-54106634 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
930730417 2:54723614-54723636 GCCCCCGGAGCCCCGGCTGGAGG + Intronic
930795529 2:55386187-55386209 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
931343875 2:61428130-61428152 GCTCTTGTTGCTCAGGCTGGAGG - Intronic
931348562 2:61469172-61469194 GCTCTTGTTGCCCAAGCTGGAGG - Intronic
931384675 2:61787478-61787500 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
931677578 2:64713010-64713032 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
931793331 2:65685523-65685545 GCCCCTGTTGCCCAGGCTGGAGG - Intergenic
933011539 2:77070661-77070683 GCTCTTGTTGCCCAGGCTAGAGG + Intronic
933012552 2:77086508-77086530 GCTCTTTTTGCCCAGGCTGGAGG + Intronic
933804746 2:85990066-85990088 GCTCTTGTTGCCCAGGCTAGAGG + Intergenic
934791175 2:97061724-97061746 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
934815268 2:97320806-97320828 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
934822427 2:97387677-97387699 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
935258761 2:101336382-101336404 CGCCCTGTAGCCCAGGCTGGAGG - Intergenic
936111069 2:109665373-109665395 GCTCTCGTTGCCCAGGCTGGAGG + Intergenic
936853883 2:116934222-116934244 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
936969997 2:118168215-118168237 GTTGCTGTTGCCCAGGCTGGAGG + Intergenic
937195649 2:120154189-120154211 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
937265525 2:120612589-120612611 GGTCCCCGAACCCAGGCTGGGGG - Intergenic
937431121 2:121839240-121839262 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
937857040 2:126679839-126679861 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
937870307 2:126781599-126781621 GCTCTTGCTGCCCAGGCTGGAGG + Intergenic
938019683 2:127895865-127895887 GTTCTTGTTGCCCAGGCTGGAGG + Intergenic
938106725 2:128536741-128536763 GCCCTTGTCGCCCAGGCTGGAGG + Intergenic
938151059 2:128883109-128883131 GCTCTTGTTGCCCAGGCTAGAGG - Intergenic
938858361 2:135340136-135340158 GCTCTTGTCGCCCAGGCTGGAGG + Intronic
938978898 2:136507166-136507188 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
939985371 2:148825051-148825073 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
940014943 2:149094450-149094472 CCTCCTGAACCCCAGGCTGGTGG + Intronic
940124154 2:150305054-150305076 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
940241803 2:151571036-151571058 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
940648229 2:156413869-156413891 GCTCTTATTGCCCAGGCTGGAGG - Intergenic
941357567 2:164512197-164512219 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
941563213 2:167075672-167075694 GCTCTTGTCACCCAGGCTGGAGG + Intronic
941650702 2:168089644-168089666 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
941879862 2:170470067-170470089 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
941958782 2:171232011-171232033 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
942176745 2:173341750-173341772 GCTCTCGTTGCTCAGGCTGGAGG - Intergenic
942354807 2:175099134-175099156 TCGCCTGTCGCCCAGGCTGGAGG + Intronic
942366072 2:175229048-175229070 ACTCTTGTCGCCCAGGCTGGAGG - Intergenic
942670843 2:178375453-178375475 GCTCTTGTTGCCCGGGCTGGAGG + Intronic
942893355 2:181018994-181019016 GCTCTTGTCGCCCAGGCTGGAGG + Intronic
943629782 2:190238495-190238517 GCTCTTGTCACCCAGGCTGGAGG + Intronic
944410338 2:199435379-199435401 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
944542437 2:200766732-200766754 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
944557963 2:200906562-200906584 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
944783809 2:203047203-203047225 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
944843347 2:203644356-203644378 GCTTTTGTTGCCCAGGCTGGAGG - Intergenic
946361242 2:219220409-219220431 GTTCCTGTGGCCCAGGATGGAGG - Exonic
946442201 2:219706316-219706338 ACTCCTGTCACCCAGGCTGGAGG + Intergenic
946624572 2:221596883-221596905 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
946672884 2:222124936-222124958 GCTCTTTTTGCCCAGGCTGGAGG - Intergenic
946823777 2:223655973-223655995 GCTCTTGTTGCCCAGGCTGCTGG + Intergenic
947380905 2:229544563-229544585 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
947539166 2:230962970-230962992 GCTCTTGTTGCGCAGGCTGGAGG - Intergenic
947808695 2:232985904-232985926 ACTCTTGTTGCCCAGGCTGGGGG - Intronic
947823136 2:233086209-233086231 GCTCTTGTTGCCCAGGGTGGAGG + Intronic
948915948 2:241035141-241035163 CCTCCCCCAGCCCAGGCAGGAGG - Intronic
948974429 2:241455411-241455433 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
948993512 2:241566328-241566350 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1169930491 20:10827542-10827564 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1170417086 20:16156308-16156330 GCTCTTGTTGCCCAGGCTGGGGG + Intergenic
1170537732 20:17357859-17357881 GCTCTTGTTGCCCAGGCCGGAGG - Intronic
1171784529 20:29449975-29449997 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1171812995 20:29760914-29760936 CCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1171906241 20:30901403-30901425 CCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1171966740 20:31536328-31536350 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1172313302 20:33934296-33934318 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1172797478 20:37551194-37551216 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1172943175 20:38668522-38668544 GCTCTTGTTGCTCAGGCTGGAGG + Intergenic
1173417948 20:42874919-42874941 GCTTTCGTTGCTCAGGCTGGAGG + Intronic
1173511585 20:43633308-43633330 GCTCTTGTGGCCCAGGCTGGAGG - Intronic
1173845247 20:46184129-46184151 GCTCTTGTTGCCCGGGCTGGAGG + Intronic
1173975238 20:47182046-47182068 TCTCTTGTTGCCCAGGCTGGAGG + Intronic
1173975486 20:47183656-47183678 GCTCCGGCAGGGCAGGCTGGTGG + Intronic
1174393152 20:50230540-50230562 GCTCTTGTTGCCCAGGCTGAAGG + Intergenic
1174393999 20:50234730-50234752 GCTCCCCAAGGCCAGGCTGTGGG + Intergenic
1174470872 20:50759597-50759619 GCTCTTGTTGCCCAGGCTGTAGG - Intergenic
1174594615 20:51674015-51674037 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1174820207 20:53720124-53720146 GCTCTTATTGCCCAGGCTGGAGG - Intergenic
1174889073 20:54370161-54370183 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1175095121 20:56535014-56535036 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1175125456 20:56748119-56748141 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1175442843 20:59003132-59003154 ACTCCAGAAGCCCAGGCAGGAGG - Intronic
1175444698 20:59012036-59012058 GCTCTTGTTACCCAGGCTGGAGG + Intergenic
1175943679 20:62549224-62549246 GCTCCTGTGGGCCAGCCTGGGGG + Intergenic
1176301763 21:5102016-5102038 GCTACCGCAGCCCAGGCAGCAGG - Intergenic
1177058040 21:16334185-16334207 GCTTTTGTTGCCCAGGCTGGAGG + Intergenic
1177103956 21:16931607-16931629 GTTCTTGTTGCCCAGGCTGGAGG - Intergenic
1177153260 21:17476081-17476103 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1177481708 21:21698243-21698265 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1177681680 21:24379363-24379385 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1178062751 21:28870431-28870453 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1178107257 21:29334136-29334158 GCTCTTTTCGCCCAGGCTGGAGG + Intronic
1178284679 21:31315644-31315666 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1178880044 21:36442184-36442206 GCTCTTGTTGTCCAGGCTGGAGG + Intergenic
1178892799 21:36534132-36534154 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1179075026 21:38112999-38113021 GCTCTCACTGCCCAGGCTGGAGG - Intronic
1179362831 21:40728449-40728471 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1179660270 21:42869978-42870000 GCTGTTGTTGCCCAGGCTGGAGG - Intronic
1179682291 21:43031892-43031914 GCTCTTGTTGCCCAGGCTGGAGG + Exonic
1179855268 21:44159884-44159906 GCTACCGCAGCCCAGGCAGCAGG + Intergenic
1179934957 21:44597463-44597485 ACTCTTGTCGCCCAGGCTGGAGG + Intronic
1180052565 21:45338170-45338192 GCTCTTGTTGCCCAAGCTGGAGG - Intergenic
1180078001 21:45472947-45472969 GCCCCCAAAGCCCAGGCAGGTGG - Intronic
1180543712 22:16478399-16478421 GCTCTTGTTACCCAGGCTGGAGG - Intergenic
1180615751 22:17125500-17125522 ACTCTCGTTGCCCAGGCTGGAGG + Intronic
1180745563 22:18086264-18086286 GCTCTTGTAGCCCAGGCCAGAGG - Intronic
1180763555 22:18227972-18227994 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1180772089 22:18396571-18396593 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1180803468 22:18646184-18646206 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1180807297 22:18723259-18723281 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1180924542 22:19544611-19544633 GCCCCTGTAGCACACGCTGGTGG + Intergenic
1181016346 22:20071095-20071117 ACTCTCGTCACCCAGGCTGGAGG - Intergenic
1181218250 22:21349078-21349100 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1181718753 22:24757044-24757066 GCTCTTGTTGTCCAGGCTGGAGG - Intronic
1182132018 22:27861266-27861288 TGCCCTGTAGCCCAGGCTGGAGG - Intronic
1182166172 22:28175698-28175720 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1182286233 22:29249645-29249667 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1182380099 22:29880730-29880752 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1182590011 22:31371942-31371964 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1182620727 22:31617097-31617119 GCTCCTGTAGCCAGGGCTGCAGG - Intronic
1182801663 22:33036722-33036744 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1182874116 22:33675259-33675281 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1182888862 22:33799471-33799493 GCTCTTGTTGCACAGGCTGGAGG + Intronic
1183052698 22:35277379-35277401 ACTCATGTTGCCCAGGCTGGAGG + Intronic
1183280062 22:36927289-36927311 GCTCAGGGGGCCCAGGCTGGAGG + Intronic
1183652190 22:39163245-39163267 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1183667803 22:39255257-39255279 CCTCCCCCATCCCAGGCTGGTGG - Intergenic
1183861831 22:40675991-40676013 GCTATTGTTGCCCAGGCTGGAGG + Intergenic
1183863265 22:40684517-40684539 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1183878098 22:40801821-40801843 GCTCTTGTTGCCCAGACTGGAGG + Intronic
1183900072 22:40998607-40998629 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1183961289 22:41413396-41413418 GCTTTTGTTGCCCAGGCTGGAGG - Intergenic
1184061983 22:42088686-42088708 GCTCTTGTCTCCCAGGCTGGAGG - Intronic
1184068190 22:42132064-42132086 CCTCTTGTTGCCCAGGCTGGTGG + Intergenic
1184142838 22:42588659-42588681 GCTCTTATTGCCCAGGCTGGAGG + Intronic
1184529427 22:45045154-45045176 CCTTCTGTTGCCCAGGCTGGAGG - Intergenic
1184584779 22:45440528-45440550 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1184765227 22:46568786-46568808 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1184794274 22:46722590-46722612 GCTCCTGCTGCCCAGACTGGAGG + Intronic
1184880179 22:47299629-47299651 CCTCGTGCAGCCCAGGCTGGAGG - Intergenic
1185164050 22:49247442-49247464 GCTCCAGGAGGCCAGGTTGGGGG + Intergenic
1185194956 22:49463356-49463378 ACTCTCGTTGCCCAGGCTGGAGG + Intronic
1185312700 22:50165427-50165449 ACTCCAGTGGCCCAGACTGGAGG - Intergenic
1203233928 22_KI270731v1_random:137561-137583 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
949548806 3:5095650-5095672 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
949690060 3:6626249-6626271 GCTCTTGTTGCCCAGTCTGGAGG - Intergenic
950219929 3:11186682-11186704 GTTCATGTAGCACAGGCTGGGGG + Intronic
951386126 3:22044978-22045000 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
952315566 3:32229295-32229317 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
952367703 3:32689318-32689340 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
952402862 3:32979007-32979029 GCTCTTGAAGCCCAGGCTGGAGG + Intergenic
953528433 3:43715191-43715213 GCTCTTGTCACCCAGGCTGGAGG + Intronic
953891072 3:46751960-46751982 CCTCCAGTCCCCCAGGCTGGAGG + Intronic
954004738 3:47581682-47581704 GCTCCAGTTGCCATGGCTGGGGG + Intergenic
954246782 3:49338627-49338649 GCTCTTGTTGCCCATGCTGGAGG - Intronic
954260912 3:49438216-49438238 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
954261315 3:49440875-49440897 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
954302290 3:49706402-49706424 GCTGCCCTAGCCCAGGAAGGTGG + Intronic
954350865 3:50042712-50042734 GCTTCTGTTGCCCAGGTTGGAGG - Intronic
954361511 3:50125090-50125112 GCTCCGCTGGGCCAGGCTGGGGG - Intergenic
955273781 3:57528059-57528081 GCTCTTGTTGCCCAGGCGGGAGG + Intronic
955367918 3:58327322-58327344 GCTCTTATTGCCCAGGCTGGAGG + Intergenic
955662836 3:61319617-61319639 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
955812623 3:62807292-62807314 GCTCTTGTCGCCCAGGCTGGAGG + Intronic
956183118 3:66535551-66535573 GCTCTTATTGCCCAGGCTGGAGG - Intergenic
957579948 3:82058729-82058751 ACTGTTGTAGCCCAGGCTGGTGG - Intergenic
957658937 3:83121269-83121291 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
957863436 3:85989977-85989999 TCTCTTGTCGCCCAGGCTGGAGG - Intronic
958504569 3:94958140-94958162 GCTCTTGTAGCCCAGGCTGAAGG + Intergenic
958790740 3:98648245-98648267 GCTCATGTCGCCCAGGCTGGAGG + Intergenic
958812823 3:98881219-98881241 GCTTTTGTAGCCCAGGCTGGAGG - Intronic
958853289 3:99354499-99354521 GCTCTTGTTGCCCAGGTTGGAGG - Intergenic
959458059 3:106588714-106588736 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
959705692 3:109336930-109336952 GCTCTGGTTGCCCAAGCTGGGGG + Intronic
959922634 3:111885289-111885311 GTTCCCGAAGGGCAGGCTGGGGG - Exonic
959993244 3:112652296-112652318 GTTCTTGTTGCCCAGGCTGGAGG + Intergenic
960613296 3:119574376-119574398 GCTCTTGTTGCCCAAGCTGGAGG + Intergenic
960829480 3:121831203-121831225 ACTCCTGTTGCCCAGGCTGGAGG + Intronic
961148076 3:124612055-124612077 GCTCTTGTAGCTCAGGCTGGAGG + Intronic
961225768 3:125244528-125244550 GCTCTTGTCCCCCAGGCTGGAGG + Intronic
961686002 3:128631443-128631465 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
961688206 3:128650299-128650321 GCTGACGTGGCCCAGGCAGGAGG + Intronic
962888675 3:139652062-139652084 GCCCCCAAAGCCTAGGCTGGAGG + Intronic
962892114 3:139681079-139681101 ACTTTTGTAGCCCAGGCTGGAGG + Intergenic
963314776 3:143747369-143747391 ACTCTTGTTGCCCAGGCTGGGGG - Intronic
963566044 3:146932502-146932524 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
963986232 3:151597882-151597904 GCTCCTGTCACCCAGGCTGGAGG - Intergenic
964129821 3:153273864-153273886 ACTCTTGTCGCCCAGGCTGGAGG - Intergenic
964279401 3:155046655-155046677 ACTCTTGTAGCCCAGGCTGGAGG - Intronic
965281390 3:166758683-166758705 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
965295733 3:166943236-166943258 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
965453586 3:168869588-168869610 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
965881458 3:173393398-173393420 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
966165945 3:177016536-177016558 GCTCTCGTTGCCCAGGCTGGGGG + Intergenic
966355174 3:179071921-179071943 GCTCCCGCATCCCCGGCGGGCGG + Exonic
966379033 3:179325052-179325074 ACTCCTGTTACCCAGGCTGGAGG + Exonic
966528247 3:180943947-180943969 GCTCTTGTTGCCTAGGCTGGAGG + Intronic
966747703 3:183294382-183294404 GCTCTTGTCGCCCAGGCTGGAGG + Intronic
966823130 3:183940889-183940911 GCTCTTGTTGCTCAGGCTGGAGG + Intronic
966889122 3:184393658-184393680 GCTCTCATCGCCCAGGCTGGAGG - Intronic
966986501 3:185185002-185185024 TCTCTTGTTGCCCAGGCTGGAGG + Intergenic
967490091 3:190080428-190080450 GCTCTTGTTGGCCAGGCTGGTGG + Intronic
967748642 3:193087923-193087945 ACACCTGTTGCCCAGGCTGGAGG - Intergenic
968017324 3:195349447-195349469 GCTCCTGTTGCTCAGGCTGGAGG - Intronic
968036210 3:195550194-195550216 GCTCCCGTGGCTGAGGCAGGTGG + Intergenic
968122668 3:196136747-196136769 GCTCTCGTCGCCCAGGCTGGAGG + Intergenic
968210236 3:196842689-196842711 GCTCTTGTGGCCCAGGCAGGAGG - Intergenic
968290131 3:197532907-197532929 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
968292307 3:197548119-197548141 GCTCCCGCAGGGCAGTCTGGGGG + Intronic
968797627 4:2718692-2718714 GCTCTCGTCACCCAGGTTGGAGG - Intronic
969110476 4:4841109-4841131 GCTCCCTCAGCACAGGCTGCTGG + Intergenic
969129776 4:4982830-4982852 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
969293032 4:6252732-6252754 GCTCTTGTCGCCCAGGCTGGAGG - Intergenic
969468565 4:7372337-7372359 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
969619048 4:8269820-8269842 GCGCCGGTGGCTCAGGCTGGCGG - Exonic
969927225 4:10596056-10596078 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
970091105 4:12409289-12409311 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
970451633 4:16172855-16172877 GCTCTTGTTGCCTAGGCTGGAGG + Intronic
970524695 4:16919389-16919411 TGCCCTGTAGCCCAGGCTGGAGG + Intergenic
970838049 4:20434452-20434474 GCTCTTGTTGCCCAAGCTGGAGG - Intronic
971208049 4:24589126-24589148 GCTCCTGTTGCCCAGGCTGGAGG - Intergenic
971228146 4:24774104-24774126 GCTCTCGTTGCCCAGGCTGGAGG - Intergenic
971367975 4:25992907-25992929 GCTCTTGTTACCCAGGCTGGAGG + Intergenic
971592056 4:28480904-28480926 GCTCTTGTCTCCCAGGCTGGAGG + Intergenic
972478693 4:39477494-39477516 GCTCTTGTCACCCAGGCTGGAGG - Exonic
972546886 4:40088531-40088553 GCTCTTGTTGCCCGGGCTGGAGG + Intronic
972549246 4:40112734-40112756 GCTCTTGTTGCCCACGCTGGAGG + Intronic
973115450 4:46451759-46451781 GCTCTTGCTGCCCAGGCTGGAGG - Intronic
973824050 4:54687403-54687425 TCTGTCGTCGCCCAGGCTGGAGG - Intronic
973894905 4:55402083-55402105 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
974035256 4:56812528-56812550 GTTCTCGTTGCCCAGGTTGGAGG - Intronic
974301416 4:60072294-60072316 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
974410688 4:61538470-61538492 GATCTTGTTGCCCAGGCTGGAGG + Intronic
974444168 4:61957600-61957622 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
975135204 4:70867851-70867873 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
975324316 4:73042453-73042475 GCTCTTGTTGCCCAGGCTGCTGG + Intergenic
975480779 4:74877781-74877803 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
975560119 4:75701458-75701480 GCTCTTGTTGCCCAGACTGGAGG + Intronic
975562324 4:75719621-75719643 GCTCTTGTTGCGCAGGCTGGAGG + Intronic
976149724 4:82079805-82079827 GCTCTTTTTGCCCAGGCTGGAGG - Intergenic
976585062 4:86787557-86787579 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
977205768 4:94163423-94163445 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
977707859 4:100091609-100091631 TCTCTTGTTGCCCAGGCTGGAGG + Intergenic
978172311 4:105687918-105687940 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
978235887 4:106459516-106459538 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
978589297 4:110307320-110307342 TCACCTGTTGCCCAGGCTGGAGG + Intergenic
978759061 4:112335228-112335250 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
979180120 4:117714947-117714969 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
979890184 4:126082407-126082429 GCGCCTGTAGTCCAGGCTGCCGG + Intergenic
979938611 4:126730697-126730719 GCTCTTGTGCCCCAGGCTGGCGG + Intergenic
980092357 4:128455782-128455804 ATGCCCATAGCCCAGGCTGGGGG - Intergenic
980667080 4:135954332-135954354 GCTCTTGTTGCCCAGGTTGGAGG + Intergenic
980791041 4:137619631-137619653 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
980824415 4:138056796-138056818 GCTCCTCTAGCCTAGGATGGTGG - Intergenic
980906822 4:138956509-138956531 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
980944480 4:139305568-139305590 GCTTTTGTTGCCCAGGCTGGAGG + Intronic
980965301 4:139515132-139515154 GCTCTTGTTGCCCAGGCTAGAGG - Intronic
981683127 4:147422827-147422849 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
981863202 4:149381805-149381827 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
982005568 4:151059901-151059923 GCTCTTGTTACCCAGGCTGGAGG + Intergenic
982016788 4:151162625-151162647 GCTCTTGTTGCCCAAGCTGGAGG + Intronic
982266164 4:153540076-153540098 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
982503954 4:156194966-156194988 GCTCTTGTTACCCAGGCTGGAGG - Intergenic
982695338 4:158592539-158592561 GCTCCCGTAGCCCAGGCTGGAGG - Intronic
982712176 4:158768865-158768887 GCTCACGTAACCCCGGCGGGAGG - Intergenic
983427868 4:167609738-167609760 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
984142035 4:176015309-176015331 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
984212045 4:176861701-176861723 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
984833245 4:183995798-183995820 GCTCCCCTGGGGCAGGCTGGTGG - Intronic
985058022 4:186051953-186051975 ACTTCTGTTGCCCAGGCTGGAGG - Intergenic
985250625 4:188021025-188021047 GCTCTTGTTGCCCAGGCTTGAGG - Intergenic
985675644 5:1230065-1230087 GCTCTCACAGCACAGGCTGGAGG + Intronic
985675673 5:1230177-1230199 GCTCTCATAGCACAGGCTGGAGG + Intronic
986330199 5:6712341-6712363 CCTCACGTCGCCCAGGCTCGCGG + Intergenic
986372139 5:7090539-7090561 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
987973775 5:24984748-24984770 CCTTCTGTAGCCCAGGCTGGAGG - Intergenic
988613906 5:32754891-32754913 TGTTCTGTAGCCCAGGCTGGAGG + Intronic
989665639 5:43850680-43850702 CCTTCTGTTGCCCAGGCTGGAGG - Intergenic
990137588 5:52665150-52665172 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
990379243 5:55205827-55205849 GCTCTTGTTCCCCAGGCTGGAGG - Intergenic
990726624 5:58762656-58762678 ACTCTTGTCGCCCAGGCTGGAGG - Intronic
991163548 5:63533723-63533745 GCTCCAAAAGCCAAGGCTGGAGG + Intergenic
991262590 5:64683193-64683215 GCTCTTGTTGCCCAGCCTGGAGG - Intergenic
991332265 5:65504422-65504444 GCTCTTGTCTCCCAGGCTGGAGG - Intergenic
991341593 5:65616752-65616774 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
991527905 5:67583267-67583289 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
991576750 5:68112527-68112549 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
991911993 5:71571665-71571687 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
992507914 5:77406242-77406264 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
992581610 5:78183832-78183854 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
992687353 5:79211574-79211596 TGTTCCGTCGCCCAGGCTGGAGG - Intronic
992909721 5:81384152-81384174 GCTCTTGTCGCCCAGGCTGCTGG + Intronic
992942938 5:81780479-81780501 GTTCTTGTTGCCCAGGCTGGAGG - Intergenic
993073929 5:83202007-83202029 GCTGTTGTTGCCCAGGCTGGAGG - Intronic
993302736 5:86232232-86232254 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
993342564 5:86742166-86742188 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
993389650 5:87303871-87303893 GCTCTTGTCGCCCAAGCTGGAGG + Intronic
993422887 5:87723493-87723515 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
994483142 5:100361389-100361411 GCTATTGTCGCCCAGGCTGGAGG + Intergenic
994985693 5:106930497-106930519 GCTCTTGTGGTCCAGGCTGGAGG - Intergenic
995078513 5:108016810-108016832 GCTTTTGTCGCCCAGGCTGGAGG + Intronic
995470550 5:112497203-112497225 GCTCTTGTCGCCCAGGCTAGAGG - Intergenic
995585586 5:113644814-113644836 TCTCCTGTTGCCCAGGCTGGAGG + Intergenic
995998035 5:118324103-118324125 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
996056533 5:118988632-118988654 GTCTCCGAAGCCCAGGCTGGAGG + Intergenic
996077685 5:119216063-119216085 GCTCTTGTCGCCCAGGCTGGAGG - Intronic
996391234 5:122964212-122964234 GTTCTTGTCGCCCAGGCTGGAGG - Intronic
996567551 5:124895958-124895980 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
996677014 5:126188050-126188072 CCTCCCAGAGCGCAGGCTGGTGG - Intergenic
996717753 5:126601234-126601256 GCTCACGGAGCCCGGGCTGCGGG + Intronic
996730128 5:126709384-126709406 TCTCCTGTTGCTCAGGCTGGAGG + Intergenic
997126441 5:131232144-131232166 ACTCCAGTAGCCCAGGCTGGAGG + Intergenic
997136304 5:131329844-131329866 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
997371772 5:133366044-133366066 GATCCAGAAGCCCAGGCAGGTGG - Intronic
997490543 5:134272204-134272226 GCTCTTGTTGCCCAGGATGGAGG + Intergenic
997552931 5:134769571-134769593 GCTCTTGTCTCCCAGGCTGGTGG + Intronic
998216892 5:140244294-140244316 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
998234458 5:140386201-140386223 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
998443950 5:142184532-142184554 GCTCTTGCTGCCCAGGCTGGAGG + Intergenic
998587847 5:143447072-143447094 GCTCCTGTAGCCCAGTCTCCTGG + Intergenic
998829903 5:146146308-146146330 GCTCTTGTTGCCCAGGCTGCTGG - Intronic
999000912 5:147922048-147922070 ACTCTTGTCGCCCAGGCTGGTGG - Intergenic
999521605 5:152356734-152356756 GCTTTAGTGGCCCAGGCTGGAGG + Intergenic
999662552 5:153880928-153880950 GGTGCTGTACCCCAGGCTGGGGG - Intergenic
1000002000 5:157147894-157147916 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
1000335214 5:160236943-160236965 GCTCTTGTTGTCCAGGCTGGAGG - Intronic
1000774096 5:165395683-165395705 TGTTCTGTAGCCCAGGCTGGAGG + Intergenic
1000776139 5:165422580-165422602 GCTCTTTTTGCCCAGGCTGGAGG - Intergenic
1001335406 5:170792407-170792429 CCTCTTGTCGCCCAGGCTGGAGG - Intronic
1001387036 5:171348439-171348461 TCCCCCGTCACCCAGGCTGGAGG + Intergenic
1001474132 5:172037397-172037419 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1001750082 5:174122608-174122630 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1001914898 5:175551749-175551771 GCTCTTGTTGCCCAAGCTGGAGG + Intergenic
1002161536 5:177316821-177316843 GCTCTTGTCCCCCAGGCTGGAGG + Intergenic
1002296815 5:178236027-178236049 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1002362226 5:178681477-178681499 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1002419428 5:179137929-179137951 GCCCCCGTTGGCCGGGCTGGAGG + Exonic
1002666843 5:180831442-180831464 GCTCTTTTTGCCCAGGCTGGAGG + Intergenic
1002993217 6:2256970-2256992 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1003174448 6:3744728-3744750 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1003344718 6:5256455-5256477 GCCCTTGTTGCCCAGGCTGGAGG - Intronic
1003353468 6:5342717-5342739 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1003415402 6:5903167-5903189 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1003604757 6:7549180-7549202 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1003814049 6:9817469-9817491 GCTCTTGTTGCCCAAGCTGGAGG + Intronic
1003885732 6:10519908-10519930 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1004061137 6:12199392-12199414 GCTCTTGCTGCCCAGGCTGGAGG + Intergenic
1004083062 6:12414815-12414837 GCTCTTGTTGCCTAGGCTGGTGG - Intergenic
1004175244 6:13334099-13334121 GCTCTCGTCGCCCAGGCTGGAGG - Intergenic
1004220996 6:13746159-13746181 ACTCTCGTTACCCAGGCTGGAGG - Intergenic
1004379752 6:15122586-15122608 GCTCTTGTCGCCCAGGCTGGAGG + Intergenic
1004389412 6:15197531-15197553 CCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1004943562 6:20587017-20587039 GCTCTTTTTGCCCAGGCTGGAGG + Intronic
1005029663 6:21497164-21497186 GCTCTTGTTGCCCAGGTTGGAGG + Intergenic
1005046872 6:21651600-21651622 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1005052210 6:21695271-21695293 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1005084613 6:21992297-21992319 GCAGCTGTAGCCCAGGATGGAGG + Intergenic
1005174883 6:23033339-23033361 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1005311896 6:24566715-24566737 CCTCCCAGAGCCCGGGCTGGTGG - Exonic
1005328553 6:24725850-24725872 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1005578755 6:27213783-27213805 GCTCTTGTCCCCCAGGCTGGAGG - Intergenic
1005724598 6:28636013-28636035 TGTCCCGCAGCCCAGGCCGGGGG - Intergenic
1005759477 6:28954552-28954574 GTTCTTGTCGCCCAGGCTGGAGG + Intergenic
1005772678 6:29091250-29091272 GCTTTTGTTGCCCAGGCTGGAGG - Intergenic
1006095012 6:31650630-31650652 GCTCTTGTTGCCCAGGATGGAGG - Intronic
1006319115 6:33309350-33309372 GCTCTTGTTGCCCAGTCTGGAGG - Intronic
1006365870 6:33614858-33614880 GCTCTTGTTGCCCAGGTTGGAGG - Intergenic
1006529140 6:34635496-34635518 ACTCTGGTTGCCCAGGCTGGAGG - Intronic
1006532324 6:34666529-34666551 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1006606196 6:35259552-35259574 GCTCCTGGAGCCCAGGCGGCCGG - Intronic
1006686360 6:35837899-35837921 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1007013095 6:38436406-38436428 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1007222119 6:40286913-40286935 GCTGCTGTAGTCCAGGCTGATGG - Intergenic
1007439266 6:41844009-41844031 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1007447508 6:41918469-41918491 GCTCTTGTTGTCCAGGCTGGAGG - Intronic
1007462354 6:42027778-42027800 GCTCTTGTTGTCCAGGCTGGAGG + Intronic
1007689789 6:43692939-43692961 ACTCCCATTGCCCAGGCTGCTGG - Intergenic
1007878155 6:45130748-45130770 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1008233332 6:49012491-49012513 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1008238062 6:49074170-49074192 GCTTTTGTTGCCCAGGCTGGAGG + Intergenic
1008447186 6:51606346-51606368 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1008744474 6:54652435-54652457 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1008912682 6:56752822-56752844 GCTCTTGTTGCCCAGGCTGAAGG + Intronic
1008940324 6:57039558-57039580 GCTCCCTTAAGCCAGGCTGTAGG - Intergenic
1009395409 6:63193757-63193779 GCTCTTGTGGCCCAGGCAGGAGG + Intergenic
1010237769 6:73589541-73589563 CCTTCTGTCGCCCAGGCTGGAGG + Intergenic
1010632000 6:78209266-78209288 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1011035107 6:82965548-82965570 GCTCTTGTTGTCCAGGCTGGAGG - Intronic
1011219628 6:85040457-85040479 GCTGTTGTTGCCCAGGCTGGAGG - Intergenic
1011488317 6:87866425-87866447 GCTCTTTTTGCCCAGGCTGGAGG + Intergenic
1011546596 6:88487961-88487983 TCCTCCGTTGCCCAGGCTGGAGG - Intergenic
1011597726 6:89032240-89032262 GCCCTTGTTGCCCAGGCTGGAGG + Intergenic
1011853693 6:91662781-91662803 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1012170836 6:96015682-96015704 CCTCTCGTGGCTCAGGCTGGGGG - Intergenic
1012350845 6:98248323-98248345 ACTCTGGTTGCCCAGGCTGGTGG - Intergenic
1012564718 6:100633842-100633864 GCTCTCGTTGCCCAGGCTGCTGG - Intronic
1012889145 6:104879289-104879311 GCTCTAGTTGTCCAGGCTGGAGG - Intergenic
1012899975 6:104994035-104994057 CCTTCTGTCGCCCAGGCTGGAGG + Intronic
1013353438 6:109326751-109326773 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1013403130 6:109818231-109818253 GCTCTTGTTGCCCAGGTTGGAGG + Intronic
1015452898 6:133391252-133391274 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1015532553 6:134235602-134235624 CCTCCTGTTGCCCAGGCTGCAGG + Intronic
1015852359 6:137587408-137587430 GCTCTTGTTGCCTAGGCTGGAGG - Intergenic
1015893906 6:137998247-137998269 ACCCCTGTTGCCCAGGCTGGAGG - Intergenic
1015982255 6:138850959-138850981 GCTCTTATTGCCCAGGCTGGAGG - Intronic
1016154453 6:140786573-140786595 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1016554145 6:145316292-145316314 GCTCCCAGAGCACAGGCTGTTGG + Intergenic
1016751994 6:147640462-147640484 GCTCTTGTCACCCAGGCTGGAGG - Intronic
1016847465 6:148582750-148582772 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1017023179 6:150157987-150158009 GCTCCCCCAGCCCAGGAAGGTGG - Intronic
1017142830 6:151207290-151207312 ACTCTTGTGGCCCAGGCTGGAGG + Intergenic
1017151021 6:151280677-151280699 CCTCTTGTTGCCCAGGCTGGAGG + Intronic
1017243644 6:152197966-152197988 GCTCTTGTTGCCCAGGCTAGAGG - Intronic
1017686713 6:156920885-156920907 ACTCTCGTTGCCCAGGCTGGAGG + Intronic
1018360153 6:163059044-163059066 GCTCTTGTTGCCCAGCCTGGAGG - Intronic
1018393600 6:163359762-163359784 GCTGCGGAAGCCCAGCCTGGGGG + Intergenic
1018992608 6:168685655-168685677 GCTCACGTGGCTGAGGCTGGTGG + Intergenic
1019216660 6:170448212-170448234 GCTCTTGTTGCCTAGGCTGGAGG - Intergenic
1019531987 7:1508052-1508074 ACTCTTGTCGCCCAGGCTGGAGG - Intergenic
1019584446 7:1790089-1790111 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1019645445 7:2126424-2126446 GCTCCTGGGGTCCAGGCTGGGGG - Intronic
1019650775 7:2156786-2156808 GCTCTTGTTGCGCAGGCTGGAGG - Intronic
1019818687 7:3221728-3221750 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1019989848 7:4683216-4683238 GCTCCAGGAGCCCAGGCCGGTGG - Intronic
1020095642 7:5367458-5367480 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1020216732 7:6197648-6197670 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
1020227753 7:6293624-6293646 GCTCTTGTCGCCCAGGCTGGAGG + Intergenic
1020233141 7:6335253-6335275 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1020306208 7:6837021-6837043 GCTCCTGTTGCCCAGGCTGGAGG - Intergenic
1020639026 7:10732913-10732935 GCTCTCATAGCCCAAGATGGTGG + Intergenic
1021220853 7:17973817-17973839 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1021358056 7:19678471-19678493 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1021678400 7:23104927-23104949 GGCCCTGTCGCCCAGGCTGGGGG - Intergenic
1021722035 7:23514098-23514120 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1021837696 7:24696557-24696579 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1022099571 7:27161181-27161203 GCTCCCAAAGCTCAGGCCGGCGG - Intergenic
1022103706 7:27184084-27184106 GCTCCCGAAGCCCTTGCAGGGGG + Intronic
1022148801 7:27577194-27577216 GCTCTTGTTGCCCAGGCTGAAGG + Intronic
1022179978 7:27909671-27909693 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
1022597552 7:31727001-31727023 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1022704358 7:32788644-32788666 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1022734464 7:33062921-33062943 GTGCCCGGAGCCCAGGCTGGAGG + Intergenic
1022741811 7:33129300-33129322 GCCCCCGGAGCCCAGGCAGGAGG + Intronic
1023075569 7:36478778-36478800 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1023390107 7:39701477-39701499 ACTCCCATTACCCAGGCTGGAGG - Intronic
1023397812 7:39767579-39767601 GCACCCATAGCCCAGGCATGGGG + Intergenic
1023538568 7:41240170-41240192 GCTCCCATGGACCAGGCTGAGGG - Intergenic
1023575342 7:41620836-41620858 ACTCCCATTGCCCAGGCTGGAGG - Intergenic
1023630442 7:42158520-42158542 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1023828199 7:44023962-44023984 GGTTCTGTCGCCCAGGCTGGAGG - Intergenic
1023837178 7:44075081-44075103 GCTCTTGTTGCCCAGGTTGGAGG + Intronic
1023885096 7:44348724-44348746 GCTCCCTTGGCCCACCCTGGTGG - Intergenic
1023944473 7:44792836-44792858 ACTCTTGAAGCCCAGGCTGGAGG - Intergenic
1024049253 7:45608571-45608593 GCTCCAGTCTCCCATGCTGGGGG + Intronic
1024704785 7:51945004-51945026 GCTCTTGTTGCCCAGGCTGCAGG - Intergenic
1024773149 7:52749566-52749588 GCTTTCGTTGCCCAGGCTGCAGG + Intergenic
1025134856 7:56402914-56402936 GCACCCATAGCCCAGGCATGGGG - Intergenic
1025138859 7:56445746-56445768 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1025740321 7:64191201-64191223 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1025779182 7:64584485-64584507 GGTCCAGAATCCCAGGCTGGTGG - Intergenic
1025829241 7:65035436-65035458 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1025850289 7:65238936-65238958 GCCCCCCTTGCCCAGGATGGGGG + Intergenic
1025916457 7:65870395-65870417 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1025938204 7:66053965-66053987 GCTCTTGTTGTCCAGGCTGGAGG + Intergenic
1025939361 7:66062861-66062883 ACTCTTGTCGCCCAGGCTGGAGG - Intergenic
1025946438 7:66108411-66108433 ACTCCTGTTGCCCAGGCTGGAGG - Intronic
1026065439 7:67068052-67068074 GCTCTTGTTGCCCAGGGTGGAGG + Intronic
1026197743 7:68187429-68187451 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1026711435 7:72743809-72743831 GCTCTTGTTGCCCAGGGTGGAGG - Intronic
1026839627 7:73662701-73662723 GCTTTTGTTGCCCAGGCTGGAGG + Intergenic
1026919787 7:74146812-74146834 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1026929582 7:74216402-74216424 GCTCTGGTCTCCCAGGCTGGAGG + Intronic
1026971734 7:74472717-74472739 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1027011471 7:74748876-74748898 GCTCTTGTTACCCAGGCTGGAGG - Intronic
1027076569 7:75197166-75197188 GCTCTTGTTACCCAGGCTGGAGG + Intergenic
1027130753 7:75589115-75589137 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1027142790 7:75671124-75671146 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1027178924 7:75923853-75923875 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1027207570 7:76113979-76114001 GCTCCTGTTGCCAAGGCTGGAGG + Intergenic
1027227553 7:76253752-76253774 ACTCTTGTTGCCCAGGCTGGCGG - Intronic
1027387216 7:77670565-77670587 GCTCTTGTTGCCCAGGCTGTAGG - Intergenic
1027657874 7:80953495-80953517 GCTCTGGTTGCCCAGGCTGGAGG - Intergenic
1027886240 7:83909538-83909560 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1029239328 7:99147756-99147778 GCTCTTATCGCCCAGGCTGGAGG - Intergenic
1029288404 7:99482820-99482842 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1029756499 7:102577411-102577433 GGTTCTGTCGCCCAGGCTGGAGG - Intronic
1029774441 7:102676484-102676506 GGTTCTGTCGCCCAGGCTGGAGG - Intergenic
1030140770 7:106302083-106302105 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1030206484 7:106957023-106957045 TCGCCTGTTGCCCAGGCTGGAGG - Intergenic
1030628369 7:111868675-111868697 GCTCTTGTTGGCCAGGCTGGAGG - Intronic
1030799381 7:113830128-113830150 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1031019653 7:116613134-116613156 GCTCTTTTTGCCCAGGCTGGAGG - Intergenic
1031540747 7:122991990-122992012 TCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1032052763 7:128659126-128659148 GTTGCTGTCGCCCAGGCTGGAGG + Intergenic
1032134213 7:129260041-129260063 ACTCACGTTGCCCAGGCTGGAGG - Intronic
1032220054 7:129987771-129987793 GCTCTTGTTGCCCATGCTGGAGG - Intergenic
1032692755 7:134305289-134305311 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1032694729 7:134325102-134325124 GCTCTTGTTGTCCAGGCTGGAGG - Intergenic
1032696340 7:134339911-134339933 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1032794975 7:135269829-135269851 GCTCCCGAACACCAGCCTGGTGG + Intergenic
1032830529 7:135620491-135620513 ACTCTTGTTGCCCAGGCTGGAGG - Intronic
1033081310 7:138300776-138300798 GTTCTTGTTGCCCAGGCTGGAGG + Intergenic
1033225851 7:139561436-139561458 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1033335171 7:140446122-140446144 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1034169326 7:149050612-149050634 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1034555590 7:151848555-151848577 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1034631342 7:152532789-152532811 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1035128087 7:156625271-156625293 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1035354121 7:158266867-158266889 GCTCCAGTGGCCCTGGCTGGTGG + Intronic
1035878579 8:3218837-3218859 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1036240402 8:7075878-7075900 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1036375150 8:8193506-8193528 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1036823550 8:11958442-11958464 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1036854390 8:12229642-12229664 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1036875751 8:12472142-12472164 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1037012827 8:13866093-13866115 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1037023202 8:13999721-13999743 CCTTCTGTTGCCCAGGCTGGAGG + Intergenic
1037337512 8:17806243-17806265 GCTCTTGTTGCCCAGACTGGAGG + Intergenic
1037597380 8:20365590-20365612 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1037618464 8:20542698-20542720 CTTCCTGGAGCCCAGGCTGGGGG - Intergenic
1037686142 8:21141208-21141230 GCTCCTATCACCCAGGCTGGAGG - Intergenic
1037755422 8:21706956-21706978 CCTCCCCCAGCCCAGGCTGTTGG - Intronic
1037810294 8:22082670-22082692 GCTTCTGTGGCCCAGGCTTGGGG - Intergenic
1038008063 8:23451052-23451074 GCTCTTGTCGCCCAGGCTGGTGG + Intronic
1038440501 8:27567994-27568016 GCTCTTGTTGCCCAGGCTAGAGG - Intergenic
1038458208 8:27692385-27692407 ACTCCTGTTGCCCAGGCTGGAGG - Intergenic
1038481136 8:27902423-27902445 GCTCCTGTGGGCCAGGCTGGTGG - Intronic
1038485549 8:27932659-27932681 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1038920419 8:32077331-32077353 GCTCTTGTCGCCCAGGCTGGAGG - Intronic
1039052229 8:33505520-33505542 ACTCTCGTTGCCCAGGCTGGAGG + Intronic
1039321263 8:36434679-36434701 ACTCCTGTCACCCAGGCTGGAGG + Intergenic
1039752505 8:40491325-40491347 CCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1040569911 8:48599123-48599145 GCTCTTGTCGCCCAGGCTAGAGG + Intergenic
1041053856 8:53962425-53962447 GCTCTTATTGCCCAGGCTGGAGG - Intergenic
1041089824 8:54291681-54291703 GCTCTTGTCTCCCAGGCTGGAGG - Intergenic
1041144073 8:54853448-54853470 GCTCCTGGTGCCCAGTCTGGTGG - Intergenic
1042219895 8:66462852-66462874 ACTCTCATTGCCCAGGCTGGAGG + Intronic
1042234830 8:66601142-66601164 GCTCTTGTTGCCCAGTCTGGAGG - Intronic
1042269574 8:66941612-66941634 GCTCTCATCACCCAGGCTGGAGG + Intergenic
1042284406 8:67092468-67092490 CACCCCGTTGCCCAGGCTGGAGG + Intronic
1042312995 8:67397092-67397114 GTTCTTGTTGCCCAGGCTGGAGG + Intergenic
1042349858 8:67766202-67766224 GTTCTTGTTGCCCAGGCTGGAGG + Intergenic
1042458140 8:69029425-69029447 GCTCTTGTTGCCCAGGCTGCTGG + Intergenic
1042948975 8:74181506-74181528 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1043223011 8:77689988-77690010 GCTCTTGTTGCCCAAGCTGGAGG - Intergenic
1043470931 8:80561640-80561662 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1043772861 8:84226437-84226459 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1044090725 8:87996760-87996782 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1044624347 8:94221883-94221905 ACTCTTGTTGCCCAGGCTGGGGG + Intergenic
1044819022 8:96143647-96143669 GGTGCATTAGCCCAGGCTGGAGG - Exonic
1045290404 8:100827933-100827955 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1045301232 8:100912346-100912368 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1045346680 8:101299922-101299944 ACTCTCGTAGCCCAGGCTAGAGG - Intergenic
1045444246 8:102243391-102243413 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1045525346 8:102936808-102936830 GCTCTTGTTGCCCAGACTGGAGG + Intronic
1045599329 8:103694652-103694674 GCCCCCGTAGCCCAGGATCCAGG - Intronic
1045609957 8:103827803-103827825 GCTCTTGTCACCCAGGCTGGTGG - Intronic
1046080865 8:109369010-109369032 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1046807842 8:118500109-118500131 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1046965773 8:120163728-120163750 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1047205481 8:122799894-122799916 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1047266377 8:123313246-123313268 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1047601437 8:126429800-126429822 ACTCTCGTTGCTCAGGCTGGAGG + Intergenic
1047740805 8:127804961-127804983 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1047778618 8:128093522-128093544 GCTCTTGTCCCCCAGGCTGGAGG - Intergenic
1047892114 8:129324075-129324097 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1048104921 8:131397375-131397397 GCTCTTGTCGCCCAGGCTGGAGG - Intergenic
1048471310 8:134706657-134706679 GCTCTTGTTGCCCAGGATGGAGG - Intronic
1048745554 8:137610955-137610977 GCTCTTGTTGCCCAGGCTGCTGG + Intergenic
1048823140 8:138397999-138398021 GCTCCCGCTGCCCTGGCTGAAGG - Intronic
1049086471 8:140482213-140482235 CCTTCTGTTGCCCAGGCTGGAGG + Intergenic
1049218816 8:141419602-141419624 GCTCTTGTTGCCCAGGCTAGAGG + Intronic
1049395887 8:142400411-142400433 CCTCTTGTTGCCCAGGCTGGAGG - Intronic
1049457480 8:142700887-142700909 GCCCCCGGAGGCCAGGCCGGCGG - Intronic
1049560089 8:143305903-143305925 TCACTCGTCGCCCAGGCTGGAGG + Intronic
1049615201 8:143572887-143572909 CCTCCAGCAGCCCAGGCAGGAGG - Exonic
1049615495 8:143574081-143574103 GCTCACGTTGCCCAAACTGGCGG + Intergenic
1049791301 8:144473895-144473917 CCTCCCGTGCTCCAGGCTGGGGG - Exonic
1049974645 9:849854-849876 GCTCTTGTTGCCCAGGGTGGAGG + Intronic
1050040456 9:1487718-1487740 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1050791487 9:9476766-9476788 TCTCTTGTTGCCCAGGCTGGAGG + Intronic
1051289693 9:15532869-15532891 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1051396717 9:16630770-16630792 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1053028715 9:34756130-34756152 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1053177856 9:35942202-35942224 GCTCCTGTTGCCCAAGCTGGAGG + Intergenic
1053241249 9:36497328-36497350 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1053302134 9:36959802-36959824 GCCTCCAGAGCCCAGGCTGGTGG - Intronic
1053463679 9:38289664-38289686 GCTCCGGTTCCCCAGCCTGGGGG - Intergenic
1054721179 9:68605261-68605283 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1056212748 9:84380339-84380361 GCTCCGGTCACCCAGGCTGGAGG - Intergenic
1056531093 9:87488487-87488509 CCTCCTGTTGCCCAGGCTGGAGG - Intergenic
1056599457 9:88035446-88035468 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1056657056 9:88518322-88518344 GCTCTTGTTGCCCAGGCTGCAGG + Intergenic
1056666020 9:88581465-88581487 GCTCTTGTTGCCCAGGCTGCAGG + Intronic
1056916410 9:90750275-90750297 ACTCTTGTTGCCCAGGCTGGTGG - Intergenic
1057283093 9:93726781-93726803 GACCCCGTAGCCCAGTCTCGAGG - Intergenic
1057588028 9:96347094-96347116 GCTCTTGTTGCTCAGGCTGGAGG - Intronic
1058316248 9:103570375-103570397 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1058327430 9:103716085-103716107 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1058484352 9:105428730-105428752 GTTCCCATTGCGCAGGCTGGAGG + Intronic
1058504686 9:105656008-105656030 GCTCCCCCAGCCCAGGTGGGTGG + Intergenic
1058681158 9:107441435-107441457 ACTCCCATCACCCAGGCTGGAGG - Intergenic
1058690583 9:107517138-107517160 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1059101493 9:111476612-111476634 ACTCTAGTTGCCCAGGCTGGAGG + Intronic
1059318256 9:113445709-113445731 CCCCCTGTTGCCCAGGCTGGAGG + Intronic
1059394810 9:114027718-114027740 GCTCCCCTGGCCCAGGCAGGTGG - Intronic
1059456514 9:114403324-114403346 GCTCCAGAAGTCCAGGCTGTGGG + Exonic
1060506856 9:124204370-124204392 GCTCTGGTTGCCCAGGCTGGAGG + Intergenic
1060619294 9:125048777-125048799 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1060663464 9:125418013-125418035 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1060782070 9:126420219-126420241 GCTCCCTCAGCTCAGGCTGCAGG - Intronic
1061000759 9:127900956-127900978 GCCCTTGTTGCCCAGGCTGGAGG - Intronic
1061142010 9:128772835-128772857 TCTCTTGTTGCCCAGGCTGGCGG + Intergenic
1061203699 9:129151164-129151186 GCTCCTGTGGCCCAGGATGCTGG - Intergenic
1061232833 9:129324870-129324892 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1061338704 9:129961598-129961620 TGTTCCGTTGCCCAGGCTGGAGG + Intronic
1061461759 9:130745115-130745137 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1061478146 9:130882967-130882989 GCTCCCGTGGCACAAGCTGGGGG + Intronic
1061487157 9:130925724-130925746 CCTCCTGAAGCCCAGGGTGGGGG - Intronic
1061525707 9:131159822-131159844 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1061753458 9:132796875-132796897 GCTCATGGAGCCCAGGGTGGTGG + Intronic
1061852978 9:133426834-133426856 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1061854080 9:133432230-133432252 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1062247347 9:135576032-135576054 GCTCCTGGTGCTCAGGCTGGTGG + Intergenic
1062308653 9:135923695-135923717 ACTCCTGGAGCCCAGCCTGGGGG - Intergenic
1062441670 9:136572503-136572525 GCTGCCCCAGCCCAGGCCGGAGG + Intergenic
1062650170 9:137571753-137571775 GCTCTTATTGCCCAGGCTGGAGG - Intronic
1062686401 9:137815648-137815670 GCTGGAGAAGCCCAGGCTGGGGG + Intronic
1203445138 Un_GL000219v1:46853-46875 GCTCTTGTTGCCCAGGCTGTAGG - Intergenic
1203363967 Un_KI270442v1:241906-241928 CCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1203501530 Un_KI270741v1:27213-27235 TCTTCCGTCACCCAGGCTGGAGG + Intergenic
1185473835 X:401361-401383 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1185554013 X:1006296-1006318 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1185589686 X:1266490-1266512 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1185651253 X:1649562-1649584 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1185671225 X:1811711-1811733 GCTCTTGTTGCCCAAGCTGGAGG + Intergenic
1186509090 X:10117198-10117220 GCTCAGGGAGCCCCGGCTGGAGG - Exonic
1186714623 X:12238155-12238177 GCTCTTGTTGCCCAGGCTGGAGG + Intronic
1188009624 X:25042245-25042267 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1188185720 X:27112211-27112233 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1188695045 X:33179872-33179894 GCTCTTGTCGCCCAGGCTGGAGG + Intronic
1188904488 X:35775618-35775640 ACTCTAGTTGCCCAGGCTGGAGG + Intergenic
1189378055 X:40481030-40481052 GCTCCCTTCGCCAATGCTGGAGG - Intergenic
1189611946 X:42746300-42746322 ACTCCAGTTGCCCAGGCTGGAGG - Intergenic
1189836570 X:45029398-45029420 GCTCTTGTTGCCCAGGCTGAGGG - Intronic
1190314123 X:49138715-49138737 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1190543328 X:51499701-51499723 GCTCCTGTTACCCAGGCTGGAGG - Intergenic
1190925293 X:54898278-54898300 GCTCCCCTAGCCCAGCCATGTGG + Intergenic
1192144738 X:68674258-68674280 GCTCTTGTCGCCCAGGCTGCAGG - Intronic
1192994654 X:76500244-76500266 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1193117378 X:77788637-77788659 GCTCTTGTAGCCCAGGCTGCAGG + Intergenic
1193133774 X:77947469-77947491 GCTCTTGTAGCCCAGACTGGAGG + Intronic
1194039508 X:88922357-88922379 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1195006238 X:100688595-100688617 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1195104593 X:101592218-101592240 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1195349074 X:103979979-103980001 GCTGCAGCAGCCCAGGCTGGGGG - Intergenic
1195351059 X:103997340-103997362 GCTGCAGCAGCCCAGGCTTGGGG + Intergenic
1195352652 X:104009490-104009512 GCTGCAGCAGCCCAGGCTGGGGG + Intergenic
1195356442 X:104044072-104044094 GCTGCAGCAGCCCAGGCTGGGGG - Intergenic
1195358369 X:104058860-104058882 GCTGCAGCAGCCCAGGCTGGGGG + Intergenic
1195650101 X:107275068-107275090 ACTCTTGTCGCCCAGGCTGGAGG + Intergenic
1196412341 X:115433524-115433546 GCTCTTGTCCCCCAGGCTGGAGG + Intergenic
1196524824 X:116719755-116719777 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1196908705 X:120464782-120464804 GCTCTTGTCCCCCAGGCTGGAGG + Intronic
1197207838 X:123805166-123805188 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1197246202 X:124169359-124169381 GCTCTTGTTGCCCAGGTTGGAGG - Intronic
1197279855 X:124522719-124522741 ACTCTTGTTGCCCAGGCTGGAGG + Intronic
1197748329 X:129947917-129947939 GCCCCCTGAGCCTAGGCTGGGGG - Intergenic
1197757942 X:130009422-130009444 TCTCTTGTTGCCCAGGCTGGAGG - Intronic
1198247862 X:134848355-134848377 GCTCTTGTTGCCCAGGCTGGAGG - Intronic
1198861379 X:141074325-141074347 GCTCCTGTTGCCCAGGCTGGAGG - Intergenic
1198901313 X:141513057-141513079 GCTCCTGTTGCCCAGGCTGGAGG + Intergenic
1199263856 X:145806966-145806988 GCTCTTGTTGCCCAGGCTGGAGG - Intergenic
1199386759 X:147232175-147232197 GCTTTTGTTGCCCAGGCTGGAGG + Intergenic
1200274893 X:154722909-154722931 GCTCTTGTCGCCCAGGCTGGAGG + Intronic
1200746374 Y:6907883-6907905 TGTTCTGTAGCCCAGGCTGGTGG + Intergenic
1201273309 Y:12276679-12276701 GCTCTTGTTGCCCAGGCTGGAGG + Intergenic
1201934212 Y:19388334-19388356 GCCCTTGTTGCCCAGGCTGGAGG - Intergenic
1201977390 Y:19866934-19866956 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic
1202249151 Y:22852038-22852060 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1202402137 Y:24485786-24485808 ACTCTTGTTGCCCAGGCTGGAGG + Intergenic
1202468643 Y:25184298-25184320 ACTCTTGTTGCCCAGGCTGGAGG - Intergenic