ID: 982700474

View in Genome Browser
Species Human (GRCh38)
Location 4:158655631-158655653
Sequence TTAGATGTGGATAAAGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982700470_982700474 5 Left 982700470 4:158655603-158655625 CCTAAATGACTGGGTAAACCTTG No data
Right 982700474 4:158655631-158655653 TTAGATGTGGATAAAGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982700474 Original CRISPR TTAGATGTGGATAAAGTAGA AGG Intergenic
No off target data available for this crispr