ID: 982704439

View in Genome Browser
Species Human (GRCh38)
Location 4:158692064-158692086
Sequence GTGAGAAGGAGAAAATCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 305}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982704439_982704442 4 Left 982704439 4:158692064-158692086 CCAGCAGATTTTCTCCTTCTCAC 0: 1
1: 0
2: 2
3: 24
4: 305
Right 982704442 4:158692091-158692113 CCTGCTTTAAAAGCAAATAGCGG 0: 1
1: 0
2: 3
3: 19
4: 208
982704439_982704443 17 Left 982704439 4:158692064-158692086 CCAGCAGATTTTCTCCTTCTCAC 0: 1
1: 0
2: 2
3: 24
4: 305
Right 982704443 4:158692104-158692126 CAAATAGCGGCCCGTCGCAGTGG 0: 1
1: 0
2: 0
3: 23
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982704439 Original CRISPR GTGAGAAGGAGAAAATCTGC TGG (reversed) Intronic
901740773 1:11340253-11340275 GGGAGCTGGAGAAAATCGGCAGG - Intergenic
902044651 1:13515175-13515197 GTAAGTAGGGGAAAAGCTGCAGG - Intergenic
902123066 1:14184274-14184296 GAGAGAAGGAGAAAATAGGAGGG - Intergenic
906297240 1:44656368-44656390 GTGACAAGGAGAAAATCGTATGG + Intronic
906354530 1:45092879-45092901 CTGAGAAGTATGAAATCTGCAGG - Intronic
908381408 1:63600135-63600157 GTGAGAAAGAGAGAATAGGCAGG + Intronic
909056047 1:70822356-70822378 CAGAGAAGGAGAATATCTGGTGG - Intergenic
909385501 1:75051024-75051046 GTGAGAGGCAGAAAACCTGATGG + Intergenic
909648360 1:77942649-77942671 GTTTGAAGGAGAAATACTGCAGG + Exonic
910028005 1:82681476-82681498 GTGAGAACTGGAGAATCTGCGGG - Intergenic
910582139 1:88840194-88840216 GGGATGAGGAGACAATCTGCTGG + Intergenic
911065640 1:93785589-93785611 GTGAGAAGGATAAAATGAGATGG + Intronic
911277140 1:95876220-95876242 GTCAGAAGGAGAGAAACTGAAGG - Intergenic
911590381 1:99740907-99740929 TTGAGAAGTATAAAATCTACTGG - Exonic
911727556 1:101258045-101258067 ATGAGAAGGAGATAATTGGCTGG - Intergenic
912284796 1:108357760-108357782 GAGAGGAGGAGAAACTCTGAGGG + Intergenic
913112454 1:115668743-115668765 ATGAGAAGGAGAGAATATACAGG - Intronic
913547845 1:119887049-119887071 GAGAGCAGCAAAAAATCTGCCGG - Intergenic
917746846 1:178018298-178018320 GAGAGAAGGAGAGAAACTACAGG + Intergenic
921115253 1:212084032-212084054 GTGAGAAAGGGAAAATATACAGG + Intronic
921882987 1:220275115-220275137 GTCAGCAGGAGAAAATGTGAGGG + Intergenic
921965076 1:221079560-221079582 GTGAGAAGGAGACAAAAAGCAGG - Intergenic
923028830 1:230230506-230230528 CTGTGTAGGAGCAAATCTGCTGG - Intronic
1063684825 10:8226802-8226824 ACAAGAAGGAGAAAATCTACAGG - Intergenic
1064084912 10:12338209-12338231 GTGAGCAGGGGAAAAGCAGCTGG + Intergenic
1065264211 10:23958003-23958025 GAGAGAATGAGAATATTTGCAGG + Intronic
1066151044 10:32618691-32618713 GTTAGAAAGAGAAAATCAGCTGG - Intronic
1066628690 10:37436882-37436904 ATGAGAAGAAGAAAATTAGCCGG - Intergenic
1068655683 10:59573694-59573716 GTGAGGAGGAGAAAATGAGGAGG + Intergenic
1069225156 10:65933892-65933914 CTGGGTAGGAGGAAATCTGCTGG + Intronic
1071070800 10:81691214-81691236 GTGACCAGGAGTAAAACTGCTGG + Intergenic
1073832783 10:107405377-107405399 GTGAGAATGAAAAATTATGCAGG + Intergenic
1074156484 10:110804650-110804672 ATAAGAAAGAGAAAATCTGAAGG + Intronic
1074293079 10:112156011-112156033 GTAAGAAGGTGATAAACTGCTGG + Exonic
1074879923 10:117647785-117647807 GCGCTAAGGAAAAAATCTGCAGG - Intergenic
1075526357 10:123190488-123190510 GTAAGAAAGGGAAAATATGCTGG - Intergenic
1075565549 10:123501404-123501426 GACAGAAGGAGACAATCTGTGGG - Intergenic
1076369959 10:129946148-129946170 GTGAGAAGCAGGGAATCCGCGGG - Intronic
1077894558 11:6443880-6443902 GGGAGAAGTAAAAAAGCTGCTGG - Intergenic
1078511279 11:11986068-11986090 ATGAGAAGGATGGAATCTGCTGG + Intronic
1078945201 11:16058721-16058743 GTGAAAATCAGGAAATCTGCAGG - Intronic
1080383996 11:31799818-31799840 GTGACAAGGAGATAATATGCGGG - Intronic
1081202217 11:40230419-40230441 GGGAGAAGAAGAAAATTGGCAGG + Intronic
1081704991 11:45177479-45177501 GAGAGAGGGAGAACATGTGCTGG - Intronic
1087617322 11:100502807-100502829 GTGAGAAGCAGAAATTGTGATGG + Intergenic
1087896084 11:103588136-103588158 GTGACAAGGAGACAAGCTGAGGG - Intergenic
1088230846 11:107672005-107672027 GTGAGAAGGGGGCCATCTGCAGG - Intergenic
1088774169 11:113066214-113066236 GTGAGAAAAAAAAAATCTGTAGG + Intronic
1089776809 11:120843397-120843419 GGGAGAAGGAGTACATCAGCAGG + Intronic
1089886695 11:121831627-121831649 TTGTGAAGTAGAAAATCAGCAGG - Intergenic
1091438564 12:494695-494717 GTGACAAGGGGACAATCTGTGGG - Intronic
1092566383 12:9670743-9670765 GTGAGATGAAGACAATCTGTGGG + Intronic
1092603688 12:10095939-10095961 GTGTCAAGGAGATAATCTGAGGG - Intronic
1092930026 12:13307102-13307124 GTTAGAAGGAGAAAAGTTGGAGG + Intergenic
1093475857 12:19553797-19553819 GGGAAAAGGAGAAAATCTTAAGG - Intronic
1094008640 12:25783107-25783129 GTGACCAGGAGGAAACCTGCAGG - Intergenic
1094358427 12:29603455-29603477 GTAAAAATGAGAAAATCTGGGGG + Intronic
1094784499 12:33830636-33830658 GTGAGAATAAGAAAACCTTCTGG + Intergenic
1096568157 12:52498442-52498464 GTGAGCAGGAGATAGTGTGCAGG + Intergenic
1097465521 12:59919939-59919961 GTGAGGAGGAGCAAAGTTGCTGG - Intergenic
1097872557 12:64612969-64612991 GTTAGAAGGGAAAAATATGCAGG - Intronic
1098806318 12:75024246-75024268 TTGAGAAGGAGAAAAGCAGTGGG - Intergenic
1100771285 12:97925271-97925293 GTTAGAATGTGAAAATCTGATGG - Intergenic
1101601864 12:106216632-106216654 GAGAGTAGGAGAAAATTTTCGGG - Intergenic
1102770328 12:115470627-115470649 GTGACAAGGAGACAGTTTGCTGG - Intergenic
1103468520 12:121161464-121161486 GTGAGATAAAGAAATTCTGCAGG - Intronic
1104782070 12:131428394-131428416 GAGAGAAGGAGAAGAGCAGCAGG + Intergenic
1105061616 12:133157150-133157172 ATGAAAAGAAGAAAATCTGATGG - Exonic
1105327199 13:19381437-19381459 CCCAGAAGAAGAAAATCTGCTGG - Intergenic
1105864450 13:24446908-24446930 CCCAGAAGAAGAAAATCTGCTGG + Intronic
1107031661 13:35860293-35860315 TTGAGAAGGAAAAAAAATGCAGG + Intronic
1107126230 13:36849852-36849874 GAGAGAAGGGGAAGATTTGCTGG - Intronic
1107892375 13:44925376-44925398 GTGAAAAGCAGGAAAACTGCAGG - Intergenic
1109365390 13:61349271-61349293 TTGAGAAGGAGAAAATGAGTGGG - Intergenic
1109400341 13:61819537-61819559 CTCAGAAACAGAAAATCTGCAGG + Intergenic
1109965472 13:69687437-69687459 GTGAGAAGGAAAACATATGTAGG - Intergenic
1112199242 13:97259330-97259352 GTGAAAAGGACAAAAGCTGGGGG - Intronic
1112542859 13:100334334-100334356 GGGGGAAGGAGAAAAGCCGCAGG - Intronic
1113255506 13:108500553-108500575 GGAAGAAGGAGAAAAACAGCAGG - Intergenic
1113835239 13:113324715-113324737 GTGAGATGGTGACAATCTGTGGG - Intronic
1115521681 14:34239380-34239402 GTGTGAAGCAGAAAGACTGCAGG + Intronic
1115721847 14:36170663-36170685 GTGAGAAGGAGAACTTCCTCTGG + Intergenic
1117202130 14:53401707-53401729 CTGAGAAGGAGAAATTGTCCTGG + Intergenic
1118706467 14:68484841-68484863 GTATGCAGGACAAAATCTGCTGG - Intronic
1120573490 14:86151353-86151375 GTGAGATGAAGAAAGTCTGAGGG + Intergenic
1121841629 14:97139141-97139163 GAGAGAAGGAGAAAGTCTTGTGG + Intergenic
1123839249 15:24229942-24229964 GTGAGAAGGAGAGATGTTGCGGG - Intergenic
1123868177 15:24543265-24543287 GTGAGAAGGAGAGAGGTTGCGGG - Intergenic
1124161804 15:27277106-27277128 GGAAGGAGGAGAGAATCTGCTGG + Intronic
1124197451 15:27644806-27644828 GGGAGGAGGAGCAAAGCTGCTGG - Intergenic
1124805714 15:32880254-32880276 GAGAGAAAGAGGAAATGTGCGGG - Intronic
1125376787 15:39038747-39038769 GTGAGAATGAAATAATGTGCAGG + Intergenic
1127035011 15:54906241-54906263 AGGAGAAGGAGGAAATCTGCTGG + Intergenic
1127882560 15:63170954-63170976 GTGAGAAGCAGAAAATCTAGAGG + Intergenic
1128283164 15:66414110-66414132 GTGAGTTGGAGATAACCTGCAGG - Intronic
1129904880 15:79179433-79179455 GCGAGAAGCAGAGAATGTGCTGG - Intergenic
1131542976 15:93289948-93289970 GTGGGAGGGAGTAAATGTGCAGG - Intergenic
1132270585 15:100520491-100520513 GTGAGAAGGAGCAGTTCAGCGGG - Intronic
1133397728 16:5461723-5461745 GTGAGGAGGAGATAGCCTGCTGG + Intergenic
1133411453 16:5572644-5572666 GTGTAATGGAGAAAATCTGCAGG + Intergenic
1133545866 16:6805988-6806010 GTGAGAAGGGGAAAAACTGTGGG + Intronic
1133840643 16:9406214-9406236 GTCAGTAGGATAAAATCTGCAGG + Intergenic
1134202632 16:12211412-12211434 GTTAGAAGGAAAAAAGCTGCAGG - Intronic
1137867897 16:51919817-51919839 GTGAGAAGAAGAAAGTATGGAGG - Intergenic
1140185588 16:72767427-72767449 ATGAGTAGGAGTAAATCTCCAGG + Intergenic
1141282495 16:82641495-82641517 GTGGGAAAGAGAATATCTGCAGG - Intronic
1146017151 17:29242943-29242965 GTGAGAAGGCCAAACTCAGCTGG + Intergenic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1148340412 17:46870249-46870271 GTGAGAAGGAGGACATTTGAGGG + Intronic
1148392107 17:47280163-47280185 GAGAGAAAGAGAGAAGCTGCTGG + Intronic
1148396967 17:47316601-47316623 GTGAGAAGGAGAAAACATACTGG - Intronic
1148982728 17:51592698-51592720 GAGAGAAAGAGAAAAGCAGCAGG - Intergenic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1152495776 17:80670396-80670418 GTCAGAAGCAGAAAATCTAATGG - Intronic
1154000803 18:10480849-10480871 GTGGGAAAGAGAAAGTCTGGGGG - Intronic
1155032798 18:21998841-21998863 GTAAGAAGGAGATAGTGTGCTGG + Intergenic
1156931234 18:42646590-42646612 GGGAGAAGGATAAAATGTGTTGG - Intergenic
1157210866 18:45740831-45740853 GTTAGAAGTGGAAATTCTGCCGG - Intronic
1157329274 18:46691744-46691766 CTGAGAAGGAGAGAAGCTACTGG + Intronic
1157942484 18:51944540-51944562 ATGAAAAGGAGAAAGTGTGCTGG - Intergenic
1158305035 18:56095890-56095912 GAGAGAAGGAAAATATCTGGTGG - Intergenic
1159720080 18:71878767-71878789 GAGACAAGGAGAAAATGTGAAGG + Intergenic
1160241500 18:77127451-77127473 GAAAAAAGGAGAAAATCTTCGGG + Intronic
1163646351 19:18491566-18491588 GGGACAAGGTCAAAATCTGCAGG - Intronic
1164335421 19:24313582-24313604 GTGAGAAAGAAAATATCTTCAGG + Intergenic
1164359468 19:27487557-27487579 GTGAGAAAGAAAATATCTTCAGG + Intergenic
1166823062 19:45592240-45592262 GTGAGAAGGAGATGGTTTGCAGG + Exonic
1166909479 19:46141691-46141713 GGGAGAAGGAGAAACCCTGAAGG - Intergenic
1167241529 19:48346383-48346405 GTGATAAGAAAAGAATCTGCTGG - Intronic
925725643 2:6868043-6868065 GTGGAAAGGAGAGAAGCTGCAGG + Intronic
925842242 2:8003434-8003456 GTAAGAAAGAAAAAATCTGATGG - Intergenic
925978670 2:9158936-9158958 GTGAAAAGGAACAAACCTGCTGG - Intergenic
928227516 2:29465150-29465172 GTGATAAGAAGAAAATCTTAAGG + Intronic
929427097 2:41854740-41854762 GTGAGATGCACAAAAGCTGCCGG - Intergenic
929601297 2:43206386-43206408 GTGACCATGGGAAAATCTGCAGG + Intergenic
930138237 2:47924407-47924429 GTGAGAAGGAAAATATATGGGGG - Intergenic
930271554 2:49263367-49263389 GTGAGAATGACAAAATCCCCAGG - Intergenic
930672604 2:54166958-54166980 GTGAAAACCAGAAAACCTGCTGG + Intronic
931680533 2:64744139-64744161 GTGAAAAGAAAAAAATCTGTGGG + Intronic
931974761 2:67630834-67630856 GTGAGAAGGACTAAATCTAGGGG + Intergenic
933162919 2:79045458-79045480 GTGAGAAGGACAGCATCTTCTGG + Intergenic
933527372 2:83458972-83458994 ATGAAAAAGAGAAAATCTGAGGG - Intergenic
933802846 2:85976793-85976815 GTGGGAAGGAGAGAACCTGGCGG - Intergenic
937381300 2:121379887-121379909 GTGAGAAGGAGGAAATTACCTGG - Intronic
938135531 2:128753529-128753551 GTGGGAAGGAGAACATCCTCGGG + Intergenic
940404900 2:153289747-153289769 GTGGGAAGGAGCTAAACTGCAGG + Intergenic
941237391 2:162992276-162992298 GTGAGAAGAAGAAAAATTGGGGG - Intergenic
941294519 2:163719656-163719678 GTAAGAAGAAGAAAACCTGTGGG + Intronic
942662910 2:178285024-178285046 GTCCCAAGGAGAAAAGCTGCAGG + Exonic
943593498 2:189827849-189827871 GGGAGAAGGAGGAAAACTGGAGG + Intronic
943671180 2:190662852-190662874 CTGAGCAGAAGAAACTCTGCAGG + Intronic
944325549 2:198399758-198399780 GGGATAAGGAGAAGACCTGCTGG + Intronic
944686146 2:202119699-202119721 GTGACAATTAGAAAACCTGCTGG + Intronic
944902299 2:204228040-204228062 TTGGGTAGGAGAAAATCAGCTGG + Intergenic
944986128 2:205179381-205179403 GTGAGGATGAGTAAATCTGAAGG - Intronic
947108858 2:226697014-226697036 ATAAGAAGTAGGAAATCTGCAGG + Intergenic
948188130 2:236037277-236037299 GTGAGAACCAGAAAACCTGCTGG - Intronic
948243085 2:236454956-236454978 GAGAGAAGGAGAAGAATTGCGGG - Intronic
948567471 2:238896082-238896104 CTGAGAAGGAGGAATCCTGCTGG - Intronic
1169453340 20:5730876-5730898 GAGAGAAAGAGAGAATCTGATGG - Intergenic
1169475640 20:5928855-5928877 CTGAGAAGGTGAAAATCAGAGGG - Intergenic
1169748853 20:8970917-8970939 GAGAGAAGCAGAAAATCGTCTGG + Intergenic
1169998893 20:11592812-11592834 GAGAGAAGGAGAAATTCTGGTGG - Intergenic
1170498269 20:16948101-16948123 GTGAGAAGGAGAAAGTGGGGAGG - Intergenic
1171872702 20:30541738-30541760 GAGAAAAGGAAAAAATGTGCAGG + Intergenic
1173703571 20:45094059-45094081 GTGAGAGAAAGAAAATCTGAAGG - Exonic
1174588037 20:51623985-51624007 TTGAGAAGGAGAAAAACCCCAGG + Intronic
1177629354 21:23706443-23706465 GTGAAAAAGAGAAAATTGGCTGG + Intergenic
1178783524 21:35629801-35629823 TTGAGAAGGAGAAATTATCCTGG - Intronic
1179033403 21:37739767-37739789 GAGAGAGGGAGAAAAGCTCCTGG + Intronic
1179284689 21:39967330-39967352 CTGGGAAGGCTAAAATCTGCAGG + Intergenic
1179514525 21:41897624-41897646 GGGAGAAGGAGGAAATTTCCTGG - Intronic
1181960270 22:26617558-26617580 GAGAGAATGAGAATATCTCCAGG - Intronic
1182752101 22:32649914-32649936 GTGGGAATGAGAAAATCAGTGGG + Intronic
1182929181 22:34156765-34156787 ATGAGAAGGTGAACATCTACAGG + Intergenic
949323775 3:2840998-2841020 TAGAGAAGGAGAAAAGCTGATGG - Intronic
951683366 3:25318065-25318087 GTGAGACGGACAAATTTTGCTGG - Intronic
951723230 3:25724655-25724677 GTGAGAAGTAGAGAATATGGAGG - Intronic
952919190 3:38273365-38273387 GAGAGAATGAGAGAATGTGCAGG - Intronic
953631495 3:44621801-44621823 CTAAGAAGCAGAAAAGCTGCTGG - Intronic
955232380 3:57110493-57110515 GTGGGATGGAGAAAATCACCTGG - Intronic
956784656 3:72632525-72632547 GTGAGAAGGTGGCTATCTGCAGG - Intergenic
959257407 3:104032049-104032071 CTGAGTAGGAGCATATCTGCTGG + Intergenic
959747443 3:109793192-109793214 GAGAGAGGGGGAAAAGCTGCTGG + Intergenic
960152140 3:114261174-114261196 GTGAGATAGAGAAAATCTAAAGG - Intergenic
962233591 3:133688296-133688318 GTGACAAGGGGACCATCTGCTGG - Intergenic
963332275 3:143927690-143927712 GTAAGAAGGCGACCATCTGCAGG + Intergenic
963422864 3:145083855-145083877 CTGGGAAGAGGAAAATCTGCAGG - Intergenic
965660806 3:171040063-171040085 AAAAGAAGGAGAAAATCTGAGGG + Intergenic
965742784 3:171893744-171893766 GTGAGAGAGAGAAAATGTGCAGG + Intronic
966430690 3:179828871-179828893 GTGAGGATGAGAAAACCTGCTGG - Intronic
967153648 3:186672977-186672999 ATGAGAAGGAGAAAATGAGGAGG + Intronic
968039056 3:195573107-195573129 GTGAAAAGGGCAGAATCTGCTGG - Intronic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
969834163 4:9825758-9825780 TTGGGAAAGACAAAATCTGCAGG + Intronic
971387644 4:26155791-26155813 GTCAGAGAGAGAAAACCTGCAGG + Intergenic
971571248 4:28213665-28213687 CTGAGAAGGAGCAATTTTGCAGG + Intergenic
971671952 4:29572256-29572278 ATGAGAAAGAGAAATTCTGAAGG + Intergenic
972185737 4:36525647-36525669 TAAAGAAGGACAAAATCTGCTGG - Intergenic
974160052 4:58126746-58126768 CTAAGAAGTTGAAAATCTGCAGG - Intergenic
974580692 4:63796840-63796862 GTCAGAAGTTGAAAATCAGCAGG - Intergenic
975779911 4:77827427-77827449 GTGAGAGAGAGAAAAGCTGGTGG - Intergenic
975881989 4:78921066-78921088 GCGAGAAGGAGATATACTGCTGG + Intronic
976068076 4:81212879-81212901 GTGAGTAGGAGGAACACTGCAGG + Intronic
976911107 4:90307146-90307168 GTGTGAAAGAGATAATCTGTGGG + Intronic
978638007 4:110834014-110834036 GTGAGAATGAGAAAACCTGTGGG - Intergenic
979282148 4:118880164-118880186 AGAAGAAGGAGAAAATCTGAAGG + Intronic
979580973 4:122359999-122360021 GTGAGAAGGTGAAAAACTAGTGG - Intronic
980688342 4:136259884-136259906 GTGAGAAGCAGAACATTTTCAGG + Intergenic
981082448 4:140648805-140648827 GAGAGAAAGGGAACATCTGCAGG - Intronic
981909738 4:149964980-149965002 GAGAGTTGGAGTAAATCTGCGGG - Intergenic
982121775 4:152150153-152150175 GAGAGAGGGAGCAAATCTCCTGG + Intergenic
982704439 4:158692064-158692086 GTGAGAAGGAGAAAATCTGCTGG - Intronic
982940169 4:161540583-161540605 ATGAGAAGGATGAAACCTGCAGG - Intronic
983944058 4:173566750-173566772 GTGAGAAGGGGCAGAGCTGCGGG - Intergenic
984679907 4:182595236-182595258 TGGAGAAGAAGAAAAACTGCTGG - Intronic
985481380 5:113098-113120 CTGAGAAAGACAAAATGTGCAGG - Intergenic
986093419 5:4533529-4533551 CTGAGAAGGAGAAAGTTGGCTGG + Intergenic
986505656 5:8448097-8448119 CTGACAAGCATAAAATCTGCAGG + Intergenic
986656893 5:10021503-10021525 GTGGGAGAGAGAAAATCTGCAGG + Intergenic
987591547 5:19934256-19934278 GTGAGAAGGACTTAATGTGCTGG + Intronic
987750567 5:22033693-22033715 GTGAGAAGAAGAAAACAGGCAGG + Intronic
987785347 5:22492166-22492188 GTGAGAAGGAAATATTCTCCAGG - Intronic
987944934 5:24594264-24594286 GTTAGAAGCAGATTATCTGCTGG - Intronic
988860556 5:35273488-35273510 GTGAGAAGGTGGTCATCTGCAGG + Intergenic
989079101 5:37597681-37597703 GTGAAAAGGAGAAAAGGAGCAGG - Intronic
990412653 5:55556305-55556327 TTGAGAAGGGGAAATTATGCTGG - Intergenic
990562765 5:56999855-56999877 TTTTTAAGGAGAAAATCTGCAGG + Intergenic
991036169 5:62130126-62130148 TAGAGAAACAGAAAATCTGCAGG - Intergenic
991463538 5:66884822-66884844 GTGAGAAGGCACAACTCTGCCGG - Intronic
992274893 5:75104847-75104869 GTGAGAAGGGGAGAATTTTCTGG - Exonic
992825682 5:80547823-80547845 GTGAGAAGGAGGAAATCAATTGG + Intergenic
993268303 5:85758660-85758682 GTGAGAAGGAGACCATCTATAGG + Intergenic
993874086 5:93285973-93285995 GAGCAAAGCAGAAAATCTGCAGG + Intergenic
994022263 5:95040857-95040879 GTGAGAATGAGAAAACATGTAGG + Intronic
994566778 5:101457928-101457950 GTGACAAGTAGAAAATATGATGG - Intergenic
995016553 5:107316301-107316323 GGGAGACGGAGAGAAACTGCTGG + Intergenic
996891647 5:128427952-128427974 CTGAGATGGAGAACATCTGTGGG - Intronic
998986714 5:147766120-147766142 GGGAGAAGGAGAAAAGATGGGGG - Intronic
999353909 5:150905303-150905325 GAGAGAGGGACAAAATCTGGGGG + Intergenic
999686365 5:154106804-154106826 GTGAGAATTAGAAAATATGCAGG - Intronic
1000492332 5:161929686-161929708 GTGAGGAGGAGAAAATGGGAAGG + Intergenic
1000927854 5:167215541-167215563 GTGGGAAGGGGAAACTCTGGAGG + Intergenic
1002395037 5:178946067-178946089 GGGAGATGGAGAAAATGTTCTGG + Intronic
1002452545 5:179327098-179327120 TTGAGAACCAGGAAATCTGCCGG - Intronic
1002862528 6:1093085-1093107 GTAAAAAGGAGGAAATATGCCGG - Intergenic
1002991290 6:2241417-2241439 GTGAGAAGGATGAGATCTGGGGG + Intronic
1003760360 6:9172756-9172778 TAGATAAGGAGAAAATCTCCGGG - Intergenic
1003817105 6:9853332-9853354 TTGTTAAGGAGAAAAACTGCCGG + Intronic
1003850257 6:10215303-10215325 GTGAGAAGCAGGAAAGCTGAGGG - Intergenic
1004318965 6:14617516-14617538 GGGAGACGGAGAGAATGTGCTGG - Intergenic
1005148016 6:22714319-22714341 GTGAGGAGTAAAAAATTTGCTGG - Intergenic
1006208353 6:32370680-32370702 GTTAGTAGGATAAAATATGCTGG + Intronic
1006390443 6:33755132-33755154 GTGTGAGGGAGAAAGTCTGCAGG - Intergenic
1007037396 6:38688997-38689019 GTGAGAAGGGGCCAACCTGCAGG + Intronic
1007119689 6:39369626-39369648 GTGAGAAGGAGCAGATCTGAAGG - Intronic
1012325335 6:97909378-97909400 GCCAGAAGGAGAAACTGTGCAGG - Intergenic
1013356471 6:109349980-109350002 GAGAGAAGGAAAAAATCCCCTGG - Intergenic
1013737514 6:113244992-113245014 GTGAGGAAGAGGAAATTTGCAGG + Intergenic
1014641316 6:123914371-123914393 GGGAGAAGGAGAGAGTGTGCAGG + Intronic
1015565530 6:134566692-134566714 CTGAGAAAGGGAGAATCTGCTGG - Intergenic
1016685860 6:146881383-146881405 GAAAGAAGGAGAAAAACTGGAGG + Intergenic
1016752997 6:147651589-147651611 GTGAGAAGGTGGCCATCTGCAGG + Intronic
1016767087 6:147806946-147806968 GTGAGAAGGTGGCCATCTGCAGG + Intergenic
1018561919 6:165108835-165108857 GAGAGAAGAAGGAAATATGCTGG + Intergenic
1019642545 7:2111960-2111982 GTGAAATGGAGTAAAGCTGCTGG - Intronic
1021364215 7:19756386-19756408 GTGTGTAGGAGTACATCTGCAGG + Intronic
1022495127 7:30848313-30848335 GTGAGATGGAGCAAAACTGCTGG + Intronic
1022755485 7:33283840-33283862 GTGAGAAGGTGAAAATATTCAGG - Intronic
1022911080 7:34900077-34900099 GTAAGAAGGAGAAAAAGAGCAGG + Intergenic
1023016993 7:35978461-35978483 TTGAGAATGTGATAATCTGCTGG + Intergenic
1023167549 7:37357640-37357662 ATGAGAAGGAAAAAATCTATAGG - Intronic
1023506520 7:40904591-40904613 GTGAGAATATGAAAATCTTCTGG + Intergenic
1025575727 7:62638954-62638976 GTGAAAAGGGAAAAATCTTCAGG - Intergenic
1026558593 7:71429200-71429222 GGGAGAAGGGGAAAGTCTGAAGG + Intronic
1026613596 7:71882355-71882377 TTGAGAAGGAGAGATTCTTCTGG - Intronic
1028569060 7:92266226-92266248 GAGAGTAGGAGAAAATATACTGG + Intronic
1028718762 7:94004631-94004653 GTGGGGAGGAGCAGATCTGCTGG - Intergenic
1029555039 7:101262954-101262976 GGGAGAAGGTGGACATCTGCAGG + Intergenic
1031779188 7:125940731-125940753 GTGAGAAGCAGAAAACATACTGG + Intergenic
1032661494 7:133988821-133988843 AAGAGATGGAGAAAATCTGGAGG + Intronic
1032789415 7:135231625-135231647 GAGAGAAGGAGAATATTTCCCGG + Intergenic
1036025993 8:4909670-4909692 GTGAGAAGGAGAAAATCCGGGGG - Intronic
1038595854 8:28885549-28885571 CTGAGATGGAGAGAATCTTCTGG - Intronic
1038808451 8:30815356-30815378 GTGAGAATGAGAATATGTTCAGG + Intergenic
1039340425 8:36643250-36643272 GTGAGAGAAAGAAAATCTTCAGG + Intergenic
1039425116 8:37479199-37479221 GTGAGAAGGAGGTGATCTGTAGG + Intergenic
1039491928 8:37954199-37954221 GTGAAAAGGGGAAAACCTGAGGG - Intergenic
1039786088 8:40835270-40835292 GAGAGGAGGAGAAAATATGAGGG + Intronic
1040293514 8:46137500-46137522 GTGAGAAGCAGAGAGACTGCAGG - Intergenic
1042847406 8:73182288-73182310 GTGACAAGGAGAAAATATGCCGG - Intergenic
1043165182 8:76894446-76894468 GAGAGTAAGAGAAAATCTCCTGG + Intergenic
1043180184 8:77078962-77078984 GAGAGAAGGAGACAATCTTGAGG + Intergenic
1045229731 8:100292021-100292043 GTGATCAGTAGAAACTCTGCTGG - Intronic
1047331325 8:123890348-123890370 CTGAGTAGGAGAAAAACTGGGGG + Intronic
1047650412 8:126914286-126914308 TTCAAAGGGAGAAAATCTGCTGG - Intergenic
1049923214 9:384455-384477 GTGTGAGGAAGGAAATCTGCAGG + Intronic
1050308133 9:4326895-4326917 GTGAGAAGGAAAAACCTTGCTGG - Intronic
1050819503 9:9859808-9859830 GTTATAAGGAGAAAGTCAGCTGG - Intronic
1050975882 9:11937315-11937337 GTGAGATGTAGAACATCTACAGG - Intergenic
1052261031 9:26516429-26516451 GTGAGAGGGATAAAATTTTCAGG + Intergenic
1052608175 9:30732570-30732592 GTGGGAAGGTGGTAATCTGCTGG + Intergenic
1055292361 9:74795533-74795555 GTGAGAAGGAGACTATCAACAGG - Intronic
1056067386 9:82950914-82950936 GTGAAGATGAGAAAATTTGCTGG - Intergenic
1056636802 9:88337983-88338005 GTGGGAAGGTGAAGATGTGCAGG - Intergenic
1056705781 9:88951799-88951821 CTGACAAGTACAAAATCTGCAGG - Intergenic
1059504358 9:114784395-114784417 GAGGGAAGGAGAGAATCTACAGG - Intergenic
1061667015 9:132166467-132166489 GGGATAAGGAGAAAATCCGCAGG - Exonic
1186633425 X:11376291-11376313 TTGAGAAGGAGAAATTATCCTGG + Intronic
1187522885 X:20029020-20029042 GTGAGAATGAGCAAAGCTGCTGG + Intronic
1187801056 X:23063356-23063378 GTGAGAAGGGGAAAATGAGAGGG - Intergenic
1188089094 X:25940177-25940199 CTTAGAAGGAGAAAATTTGCTGG - Intergenic
1188885823 X:35547471-35547493 GTGACTAGGAGGATATCTGCTGG + Intergenic
1189277175 X:39795287-39795309 GTGTGAAGGAGAGAATCTTTCGG + Intergenic
1189880624 X:45487742-45487764 GTGAGAAGTACAAAAATTGCGGG + Intergenic
1190221760 X:48516519-48516541 GTGCTAAGGAGAAAATGTGTAGG + Intronic
1191992485 X:67053383-67053405 GTGAGAAGGAGAAGATGTTTGGG + Intergenic
1193630283 X:83877132-83877154 GTGAGAAGGAGATTATGTCCAGG - Intronic
1194250246 X:91565740-91565762 ATGTGAAGAAGAAAATCTACTGG - Intergenic
1195368629 X:104151145-104151167 GTGATAAGGAGGAAACCTGGGGG - Intronic
1197859383 X:130953380-130953402 TTAAGTAGGAGAAAATCTTCAGG - Intergenic
1198246601 X:134838259-134838281 GGGAGAAACAGAAAATCTACTGG - Intronic
1198278808 X:135122210-135122232 GTGGCCAGGAGAAAACCTGCGGG - Intergenic
1198292152 X:135250306-135250328 GTGGCCAGGAGAAAACCTGCGGG + Intronic
1199065990 X:143418774-143418796 GTGGGCAGCAGAAAATCTGTAGG - Intergenic
1199500754 X:148503132-148503154 GTAAGAAGGAGAAATTTTCCTGG - Intronic
1199789191 X:151135222-151135244 CTGAGTAGGAGAAAACCTGGGGG - Intergenic
1200278548 X:154757309-154757331 GTGAGAAGGGGAAACTCTAGGGG - Intergenic
1200569205 Y:4806989-4807011 ATGTGAAGAAGAAAATCTACTGG - Intergenic
1200881254 Y:8214017-8214039 GTAAGAAAGAGAAAATATGAAGG + Intergenic
1202604615 Y:26628165-26628187 CTCAGAAGAAGAAAATCTGTTGG + Intergenic