ID: 982707275

View in Genome Browser
Species Human (GRCh38)
Location 4:158723755-158723777
Sequence GTACAATGCCTGGCATAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982707273_982707275 15 Left 982707273 4:158723717-158723739 CCTCGGAAGGTCGTTTTGAGGAT No data
Right 982707275 4:158723755-158723777 GTACAATGCCTGGCATAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982707275 Original CRISPR GTACAATGCCTGGCATAAAC TGG Intergenic
No off target data available for this crispr