ID: 982712160

View in Genome Browser
Species Human (GRCh38)
Location 4:158768828-158768850
Sequence TGCGGCCAGGAGCGGGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 365}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712160_982712170 3 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA 0: 1
1: 0
2: 0
3: 35
4: 365
Right 982712170 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG 0: 1
1: 1
2: 10
3: 137
4: 916
982712160_982712181 20 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA 0: 1
1: 0
2: 0
3: 35
4: 365
Right 982712181 4:158768871-158768893 GCCGGGGTTACGTGAGCCCGGGG No data
982712160_982712168 2 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA 0: 1
1: 0
2: 0
3: 35
4: 365
Right 982712168 4:158768853-158768875 TCCCACCTCCCGCCTCCCGCCGG No data
982712160_982712180 19 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA 0: 1
1: 0
2: 0
3: 35
4: 365
Right 982712180 4:158768870-158768892 CGCCGGGGTTACGTGAGCCCGGG No data
982712160_982712172 4 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA 0: 1
1: 0
2: 0
3: 35
4: 365
Right 982712172 4:158768855-158768877 CCACCTCCCGCCTCCCGCCGGGG No data
982712160_982712184 24 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA 0: 1
1: 0
2: 0
3: 35
4: 365
Right 982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG No data
982712160_982712185 27 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA 0: 1
1: 0
2: 0
3: 35
4: 365
Right 982712185 4:158768878-158768900 TTACGTGAGCCCGGGGCGGGCGG No data
982712160_982712179 18 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA 0: 1
1: 0
2: 0
3: 35
4: 365
Right 982712179 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 30
982712160_982712183 23 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA 0: 1
1: 0
2: 0
3: 35
4: 365
Right 982712183 4:158768874-158768896 GGGGTTACGTGAGCCCGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712160 Original CRISPR TGCGGCCAGGAGCGGGCGGG CGG (reversed) Intergenic
900092181 1:925313-925335 TGCGGCCGGGTGCGAGCGCGCGG + Intronic
900184089 1:1324924-1324946 AGAGGGCCGGAGCGGGCGGGCGG + Exonic
900309350 1:2025836-2025858 TGCTGCCGGGAGCTGGCGGGCGG + Intronic
900457438 1:2784029-2784051 TGAGGCCAGGCGAGGGCAGGGGG + Intronic
900620069 1:3582677-3582699 TGAGGCCAGGAGCTGGATGGGGG - Intronic
900621000 1:3587921-3587943 AGAGGCCAGGAGGGGGCAGGAGG + Intronic
900621031 1:3587991-3588013 AGAGGCCAGGAGGGGGCAGGAGG + Intronic
900621074 1:3588101-3588123 AGTGGCCAGGAGGGGGCAGGAGG + Intronic
900621177 1:3588341-3588363 AGTGGCCAGGAGGGGGCAGGAGG + Intronic
900621198 1:3588391-3588413 AGTGGCCAGGAGGGGGCAGGAGG + Intronic
900621219 1:3588441-3588463 AGAGGCCAGGAGGGGGCAGGAGG + Intronic
900621254 1:3588531-3588553 AGTGGCCAGGAGGGGGCAGGAGG + Intronic
901016726 1:6236100-6236122 GGCGGGGAGGGGCGGGCGGGCGG - Intergenic
901045381 1:6393026-6393048 TGCGGCCAGGAGGAGCCGGCTGG + Intronic
901245336 1:7725886-7725908 TCCAGCCAGGAACAGGCGGGTGG + Intronic
901245345 1:7725932-7725954 TCCAGCCAGGAACAGGCGGGTGG + Intronic
901930786 1:12595383-12595405 TGGGCCCAGGGGCGGGCGCGGGG + Intronic
902286471 1:15411094-15411116 GGCGGGCAGGAGCGGGAGGGAGG - Intronic
902836937 1:19053542-19053564 TGAGGCCAGGAGCCGGCAGGAGG - Intergenic
902916749 1:19644291-19644313 TGCGGCCCCGGGCGGGCGCGCGG - Intronic
903271572 1:22191820-22191842 TGGGGAGAGGAGCGGGTGGGAGG + Intergenic
903324645 1:22563143-22563165 TGCGGGCAGGAGCGAGCATGCGG + Intergenic
903570045 1:24297647-24297669 TGCAACCAGGAGCGGAAGGGAGG - Intergenic
904317185 1:29673157-29673179 TGCGTCCAGGCCCGGGTGGGAGG - Intergenic
904612101 1:31731421-31731443 TGGGGGCAGGAGTGGGAGGGAGG + Intronic
904690767 1:32292042-32292064 TGAGCCCAGGAGGGGACGGGCGG + Intergenic
904822720 1:33256126-33256148 TCCGGCGCGGCGCGGGCGGGGGG + Intergenic
906256586 1:44355191-44355213 GGCGGCCGGGAACGGGCGGTGGG - Exonic
906264404 1:44417695-44417717 AGCGGCGAGGGGCTGGCGGGCGG - Intronic
907268261 1:53275752-53275774 TGCTGCCAGGAGAGGGCAAGGGG + Exonic
907868180 1:58419023-58419045 TGGGGCCAGGAGGGTGCTGGAGG - Intronic
908823960 1:68115902-68115924 TGCTGCCAGGAGGGAGAGGGTGG - Intronic
909483121 1:76146804-76146826 TGCTGCCAGGAGGGGTTGGGTGG + Intronic
913959222 1:143326535-143326557 TGCTGCCTGCACCGGGCGGGGGG - Intergenic
914053539 1:144151915-144151937 TGCTGCCTGCACCGGGCGGGGGG - Intergenic
914125658 1:144814626-144814648 TGCTGCCTGCACCGGGCGGGGGG + Intergenic
915916671 1:159944727-159944749 TGCGGCCAAGAGTGGGTTGGAGG - Intronic
917962273 1:180154727-180154749 CGCGCCCAGGAGCGGCCGGCGGG + Intergenic
919871996 1:201829088-201829110 GGCGGGCGGGAGCGGGCGGAGGG - Intergenic
920409753 1:205749920-205749942 TGAGGCCTGGAGCGGGTTGGAGG - Intronic
924289702 1:242524669-242524691 TGCCGCAAGGAGCCGGCGAGCGG - Intronic
924428924 1:243979643-243979665 ATCGGCCAGGAGTGGGGGGGTGG + Intergenic
1062874075 10:931457-931479 TGAGGCGAGGAGCCCGCGGGCGG - Exonic
1063657773 10:8009156-8009178 TGGGGCCGGGGGCGGGCGCGGGG - Exonic
1069557780 10:69408869-69408891 CGGGGCCTGGAGGGGGCGGGGGG - Intronic
1070305367 10:75235931-75235953 CGCGGGCAGGAGGCGGCGGGAGG + Exonic
1070800481 10:79242321-79242343 TGTGACCAGGAGCTGGCGGCAGG - Intronic
1073323160 10:102627924-102627946 TGCGGGCAGGAGCGGGGGAGGGG - Intronic
1074399082 10:113126887-113126909 CGCGGCCGGCGGCGGGCGGGCGG + Intronic
1075112480 10:119598208-119598230 TGCGGGCGGGAGCGGGGGGAAGG + Intergenic
1075345972 10:121682081-121682103 TACTGCCAGGAGAGGGAGGGGGG + Intergenic
1076317415 10:129552178-129552200 CTCGGCCATGAGCGGGTGGGCGG - Intronic
1076525904 10:131112322-131112344 TGGGCCCAGGAGGGGCCGGGTGG - Intronic
1076658942 10:132042568-132042590 TGCAGCCAGGATGGGGAGGGAGG - Intergenic
1076695454 10:132245191-132245213 TACAGCCAGGAGCAGGAGGGAGG + Intronic
1076792873 10:132786090-132786112 TCCGGCGCGGGGCGGGCGGGCGG + Intergenic
1076839401 10:133038661-133038683 TGCAGCCAGGAGCAGACAGGAGG - Intergenic
1076916337 10:133424532-133424554 AGCGGGAAGGAGCGGGCGGGCGG + Exonic
1076936444 10:133569327-133569349 AGCGGGAAGGAGCGGGCGGGCGG + Intronic
1077038002 11:504474-504496 TCCGCCCAGGCGGGGGCGGGCGG + Intronic
1077386125 11:2270344-2270366 CGGGACCTGGAGCGGGCGGGTGG - Exonic
1077474823 11:2781407-2781429 TGAGGCCAGGGGCAGGCTGGGGG + Intronic
1077773858 11:5249901-5249923 TGAGGCCAGGGGCCGGCGGCTGG - Intronic
1077774361 11:5254825-5254847 TGAGGCCAGGGGCCGGCGGCTGG - Exonic
1078934849 11:15941465-15941487 TGCGGCCGGGGGCGGACGGTGGG + Intergenic
1083266666 11:61550167-61550189 TGAGGCTAGGGGAGGGCGGGAGG - Intronic
1083965798 11:66042969-66042991 GGCGGCCAGGCGCGAGCTGGCGG + Exonic
1084151468 11:67289632-67289654 TGCGGAGCTGAGCGGGCGGGGGG - Intronic
1084664281 11:70568069-70568091 TGAGGCCAGCAGCGGGGTGGTGG + Intronic
1084787759 11:71453287-71453309 TGCGGCCAGGATGGGCCGGAAGG + Exonic
1084892649 11:72244131-72244153 TGCGGCCGCGACGGGGCGGGCGG - Exonic
1085666213 11:78417608-78417630 GCCGCCCAGGGGCGGGCGGGGGG - Intronic
1087739152 11:101868172-101868194 TACGGCCAGGGGTGGGAGGGAGG - Intronic
1090345108 11:126063017-126063039 TCCGGCCGGGTGCGGGCCGGCGG - Intronic
1090358969 11:126159839-126159861 TGGGGGCAGGCGAGGGCGGGAGG - Intergenic
1091473872 12:753251-753273 TGCGGCGAGCGGCGGCCGGGCGG - Exonic
1092492244 12:8956200-8956222 TGGTGCCAGGAGAGGGCAGGAGG - Intronic
1093493171 12:19726832-19726854 AGGGCCCAGGAGCAGGCGGGAGG - Intergenic
1096241682 12:49963122-49963144 TGGGGCCAGGCACGGGCAGGAGG + Intronic
1096255018 12:50057604-50057626 TCCGGCCGGGAGGCGGCGGGAGG - Exonic
1096772539 12:53945257-53945279 TGGGGCAAGCAGCGGGTGGGTGG - Exonic
1097164611 12:57076948-57076970 TGCGGGGCGGGGCGGGCGGGGGG + Intronic
1100566337 12:95797583-95797605 TGTGGCGAGGAGTGGGTGGGGGG + Intergenic
1103535851 12:121633343-121633365 GGCGGCCAGTGGCTGGCGGGGGG + Intronic
1103779338 12:123388943-123388965 GGCGGCTGCGAGCGGGCGGGAGG + Intronic
1103907968 12:124336968-124336990 TCCAGCCCGGAGCGGGCTGGGGG + Exonic
1104917786 12:132274927-132274949 TGCTGCCAGGAGCCCACGGGGGG - Intronic
1104930925 12:132339110-132339132 TGCGGCGAGGTGGGGCCGGGAGG + Intergenic
1104952093 12:132445707-132445729 TGAGGCCAGGAGCACGCCGGTGG - Intergenic
1105413736 13:20192524-20192546 TGGGGCCGGGCGCGCGCGGGAGG - Intronic
1105440926 13:20415118-20415140 TGGGGCCGGGTGCGGGCGAGGGG - Intronic
1111672438 13:91348004-91348026 TGCGGCCCGGGTCTGGCGGGCGG + Intergenic
1113520413 13:110936641-110936663 TGCGGCCAGGTGAGTGTGGGCGG + Intergenic
1113917811 13:113884550-113884572 AGGGGCCAGGGGCGGGTGGGTGG - Intergenic
1114623492 14:24113831-24113853 TGCCCTCAGGAGCGGGCGGAGGG + Intronic
1117327848 14:54685277-54685299 GGCTGCCAGGAGCTGGGGGGGGG - Intronic
1118857585 14:69636198-69636220 TGCTGCCTGGAGTGGGCGGCAGG + Intronic
1119475166 14:74922891-74922913 TGCGGCCAGGAGGCAGAGGGAGG + Intronic
1120871308 14:89339623-89339645 TGCGGGCAGGATCGGGCAGGCGG + Intronic
1120875503 14:89371623-89371645 TGGGGCTAGGAGCAGGCAGGAGG - Intronic
1121120423 14:91372526-91372548 TGCGGGGGGGGGCGGGCGGGGGG + Intronic
1121547059 14:94770178-94770200 TGCGGCTAGGGGAGGGCGGGAGG - Exonic
1121605567 14:95237538-95237560 GGAGGCCAGGAGAGGGAGGGTGG + Intronic
1121645416 14:95514868-95514890 TGCAGCCTGGAGCGGGCTGCCGG - Intergenic
1122269025 14:100560078-100560100 TGTGGGCAGGAGAGGGTGGGTGG + Intronic
1122523574 14:102363524-102363546 TGGGGCCAGGCGCCGGTGGGCGG - Intronic
1122866263 14:104605312-104605334 TGAGGCCAGGTGTGGGCAGGAGG + Intronic
1122884225 14:104703473-104703495 GGCGGGCAGGAGCGGGCATGCGG - Intronic
1124232135 15:27954858-27954880 CAGGGCCAGGAGCGGGCTGGTGG + Intronic
1124475364 15:30028464-30028486 TGAGGCCAAGAGCAGGCAGGTGG - Intergenic
1124595413 15:31087837-31087859 GGCCGCCAGGAGCTGGTGGGAGG + Intronic
1127674824 15:61228972-61228994 GGCGGCCGGGAGCGGGCGCCCGG - Intronic
1128240448 15:66097628-66097650 TGGGGCCAGGAGAGGGTGAGTGG - Intronic
1128499283 15:68216193-68216215 TGAGGCCAGGAGTGGGCTCGTGG - Intronic
1129232830 15:74206205-74206227 GGGGGCCAGGAGGGGGCAGGTGG - Intronic
1129719805 15:77871896-77871918 TGGGGTCAGGAGCTGGTGGGAGG - Intergenic
1130161716 15:81407943-81407965 TGCGGGCAGGAGCTGGGGAGGGG + Intergenic
1130335289 15:82952708-82952730 CGCCGCCAGGCGCGGGCGGGCGG + Exonic
1130362929 15:83207569-83207591 TGAGGCAAGGGGTGGGCGGGGGG + Exonic
1130726288 15:86442923-86442945 TGCGGGCAGGAGCAGGGGGTGGG - Intronic
1131150090 15:90042349-90042371 TGCTGCCTGGAGGGGGTGGGGGG - Intronic
1131261437 15:90890068-90890090 TGCAGGCAGGGGCGGGTGGGAGG - Intronic
1131510108 15:93045037-93045059 GGCGCCCAGGAGGGGCCGGGGGG + Exonic
1132498833 16:275868-275890 TGCGCCCGGGGGCGGCCGGGGGG + Exonic
1132730119 16:1356930-1356952 TGCGGGCGGGAGTGTGCGGGTGG + Intronic
1132754362 16:1475329-1475351 TGAGGGCAGGAGCCGGCTGGAGG + Exonic
1132779459 16:1614615-1614637 TGCGGCCGGGAGAGGGGAGGCGG - Intronic
1132871680 16:2118220-2118242 TGGGGGCAGGAGGTGGCGGGGGG + Exonic
1132943554 16:2520243-2520265 TGGGGGCGGGGGCGGGCGGGCGG + Intronic
1133014852 16:2934775-2934797 TGGGGTCAGGAGCGGGGGTGAGG - Intronic
1134550729 16:15137298-15137320 TGGGGGCAGGAGGCGGCGGGGGG + Intronic
1134708519 16:16317326-16317348 TGGGGGCAGGAGGCGGCGGGGGG - Intergenic
1134715734 16:16357359-16357381 TGGGGGCAGGAGGCGGCGGGGGG - Intergenic
1134951083 16:18351319-18351341 TGGGGGCAGGAGGCGGCGGGGGG + Intergenic
1134959023 16:18394800-18394822 TGGGGGCAGGAGGCGGCGGGGGG + Intergenic
1136478274 16:30526499-30526521 GGCGGCGCTGAGCGGGCGGGAGG - Exonic
1136485938 16:30571675-30571697 TGAGGCCGGGAGCGGGGAGGCGG - Exonic
1136548607 16:30969471-30969493 TTCGGCCAGGAGCCGGCGCCCGG - Intronic
1136927518 16:34388604-34388626 CGTGGCCAGGGACGGGCGGGCGG + Intergenic
1136977056 16:35023202-35023224 CGTGGCCAGGGACGGGCGGGCGG - Exonic
1137251914 16:46747293-46747315 TGGGGACAGGAGGTGGCGGGTGG + Intronic
1138229029 16:55324383-55324405 TGCGGCCCGGAGGAGGCGAGAGG - Exonic
1139365418 16:66429448-66429470 GGTGGCAAGGAGCGGGTGGGCGG + Intronic
1139467894 16:67164024-67164046 TGTGTCCAGGACCGAGCGGGTGG - Exonic
1139593807 16:67947100-67947122 TGCGGCCTGCAGTGGCCGGGTGG + Exonic
1141608674 16:85169518-85169540 CGCGGCCATGAGCGGGCGGCCGG + Intergenic
1141644577 16:85360361-85360383 TGCGGCCGGGTGGGGGCAGGTGG + Intergenic
1142006029 16:87689951-87689973 TGGGGCGAGGAGCAGGCCGGGGG + Exonic
1142375791 16:89706578-89706600 TGCTACCAGGAGCTGGCTGGGGG - Intergenic
1143490382 17:7282374-7282396 GGCGGCCAGGAGTGGGGGTGGGG - Intronic
1144692903 17:17280700-17280722 GGCCGCCGGGAGCGGGCGGGAGG - Intronic
1144724955 17:17497047-17497069 AGAGGCTAGGAGCAGGCGGGTGG + Intergenic
1144756244 17:17682053-17682075 TGCGGCCAGCTGAGGTCGGGTGG + Intronic
1146371237 17:32266433-32266455 CGCGGGCAGGAGGGGGCGGAGGG + Intronic
1147636487 17:41967266-41967288 CGCGCCCGGGTGCGGGCGGGAGG + Intronic
1148777956 17:50106085-50106107 AGCGGCGGGGAGCGGGCGGTGGG + Intronic
1148793189 17:50184987-50185009 GGCGGGCAGGAGCGGGCTGAGGG + Exonic
1149667743 17:58377676-58377698 TGGGGGCAGGAGGGGGTGGGTGG - Intronic
1150326661 17:64263270-64263292 TGTGCCCGGGGGCGGGCGGGCGG - Intronic
1150692349 17:67377426-67377448 GGCTGCCAGGGGCGGGCGGGAGG - Intronic
1150764715 17:67993840-67993862 TCAGGCCAGGCGCGGGCGGCGGG + Intergenic
1151438689 17:74114475-74114497 TGGGGGCAGGGGCAGGCGGGAGG + Intergenic
1151658137 17:75505075-75505097 TGCGGCCAGGGGTGGGGGGCGGG + Intronic
1151785659 17:76273749-76273771 TGAGGCCAGGAGAGAGCTGGTGG + Intergenic
1151976723 17:77487641-77487663 AGTGGCCAGGGGCGGGCTGGGGG + Intronic
1152123161 17:78431349-78431371 TGGGGCCAGGAGGGGGAGAGGGG - Intronic
1152197189 17:78924865-78924887 CTCGGCCAGCGGCGGGCGGGCGG + Intronic
1152657869 17:81528317-81528339 CGCGGGCAGCAGAGGGCGGGCGG - Intergenic
1152924224 17:83080067-83080089 CGCGGCCGGGGGCGGGCGCGGGG + Intronic
1153911177 18:9708042-9708064 TGCGGCCAGGCGGGGCCGGGAGG + Intergenic
1154326597 18:13395653-13395675 TGGGGGCAGGAGCTGGCGTGGGG + Intronic
1154336883 18:13473068-13473090 TGCTGGCAGGCGGGGGCGGGGGG - Intronic
1157285469 18:46374423-46374445 GGCTGCCAGGGGCTGGCGGGAGG - Intronic
1158203669 18:54966958-54966980 TGGGGCCAGGTGGGGGCAGGTGG + Intergenic
1158954095 18:62523379-62523401 TGCGAGCGGGGGCGGGCGGGAGG - Exonic
1159045710 18:63367133-63367155 AGGGGCCCGGAGCGGCCGGGCGG + Exonic
1160563179 18:79771643-79771665 GGCGGCCAGGCATGGGCGGGTGG - Intergenic
1160711320 19:552485-552507 AGCGGCCAGGAGCCTGGGGGCGG - Intergenic
1160731626 19:643927-643949 TGGGGGCAGGAGCGGAGGGGAGG + Intergenic
1160749211 19:726128-726150 TGCCGCCAGGACCCTGCGGGAGG - Exonic
1160766820 19:812542-812564 CGGGGCCGGGGGCGGGCGGGGGG - Exonic
1160777541 19:862874-862896 TGTGGCCAGGAGCTGGGGGCGGG + Intronic
1160788723 19:913111-913133 TGCGGCCCGGAGGCGGCGGAGGG - Exonic
1160823334 19:1068150-1068172 TGCGGGGAGGCGCGGGAGGGGGG - Intronic
1161065776 19:2236561-2236583 AGCGGCCAGGCGCAGGCGGAGGG + Exonic
1161215808 19:3094581-3094603 TCCGGCCAGGGCCGGGCCGGGGG + Exonic
1161730753 19:5959167-5959189 TGGGGCCAGGGGCAGGCGGTGGG + Intronic
1161971338 19:7582600-7582622 GGCGGCCAGGAGAGGGAGGGCGG - Intergenic
1163138634 19:15331942-15331964 GGCGGTCGGGGGCGGGCGGGGGG - Intronic
1163213363 19:15858124-15858146 TGTGGCCAGAAGCGAGTGGGTGG - Intergenic
1163391171 19:17030930-17030952 TGCGGCCAGCAGCAAACGGGGGG - Intergenic
1163433989 19:17284201-17284223 TCCTGCCAGGAGGTGGCGGGAGG + Exonic
1163441255 19:17323706-17323728 AGCGGCCAGGGCCTGGCGGGGGG + Exonic
1163502832 19:17686769-17686791 CGCGGCGGGGAGCGGGCGGGCGG + Intronic
1164650409 19:29887151-29887173 TGCGGCGGGGGGCGGGTGGGAGG - Intergenic
1165015173 19:32875409-32875431 TGCAGCCAGGAGTGGGAGAGGGG - Intergenic
1165060995 19:33205157-33205179 TGGGGCCAAAAGCGGGCAGGTGG - Intronic
1165148352 19:33746699-33746721 TGCGGCCAGGAGTTAGTGGGAGG + Intronic
1165157332 19:33796420-33796442 TGTCGCCAGGCGCGGGCGCGCGG + Intronic
1165242881 19:34481798-34481820 GGCGGCCACGCGCGGGCCGGGGG - Exonic
1165330629 19:35139617-35139639 TCAGGCCGCGAGCGGGCGGGCGG + Intronic
1165349601 19:35268815-35268837 GGCCGCCCGGAGCCGGCGGGCGG + Intergenic
1166090611 19:40506322-40506344 TGCCGCCCAGAGCGAGCGGGTGG + Exonic
1166092581 19:40519813-40519835 CGCGCCCAGGAGGCGGCGGGCGG + Exonic
1166155455 19:40908401-40908423 CGGGGCCAGGAGCGGGCCTGCGG - Intergenic
1166764669 19:45245577-45245599 TCCGGCCTGGAGCGGGGGTGAGG - Intronic
1167280942 19:48568191-48568213 TGAGCCCAGGAGCCGGAGGGTGG + Intronic
1167636316 19:50658147-50658169 CGGGGCCTGGAGCGAGCGGGAGG + Intronic
1168152905 19:54458582-54458604 TGCGGCCAGGAGCTGGTCTGAGG - Intronic
1168691640 19:58381000-58381022 GGCGGCCCGGAGGTGGCGGGAGG - Exonic
1202692936 1_KI270712v1_random:104336-104358 TGCTGCCTGCACCGGGCGGGGGG - Intergenic
925265601 2:2564362-2564384 TGCAGACAGGCGGGGGCGGGGGG + Intergenic
925266882 2:2571785-2571807 GGCAGCGAGGAGCGGGAGGGAGG - Intergenic
925368059 2:3324570-3324592 TGCCGCCTTGAGCGGGTGGGTGG - Intronic
927680728 2:25137317-25137339 TGGGGACAGGAGCGGGCAGAAGG - Intronic
927931993 2:27051506-27051528 GGCGGGCAGGAGCGGCCGGAGGG - Intronic
929936746 2:46298759-46298781 AGCGGCCGGGAGAGGGCGAGAGG - Intronic
931665910 2:64609450-64609472 GGCGCCCCCGAGCGGGCGGGCGG - Intergenic
932231511 2:70087598-70087620 AGCGAGCGGGAGCGGGCGGGAGG - Exonic
932345407 2:70992048-70992070 TGCTGCCCAGAGCGGGCTGGGGG - Intronic
932823956 2:74923591-74923613 TGTGGCCAGGACCAGGCTGGTGG - Intergenic
933953462 2:87349626-87349648 TGCTGCCTGCACCGGGCGGGGGG + Intergenic
934237668 2:90245875-90245897 TGCTGCCTGCACCGGGCGGGGGG + Intergenic
934275534 2:91570855-91570877 TGCTGCCTGCACCGGGCGGGTGG - Intergenic
934460103 2:94209214-94209236 TGCTGCCTGCAGCGGGGGGGCGG + Intergenic
934754481 2:96816097-96816119 GGCGGCCAGGGGCGGGCCGGGGG - Intergenic
935112420 2:100105146-100105168 CGGGGCCGGGCGCGGGCGGGCGG - Intronic
935196348 2:100819270-100819292 TGCGGCCAGGAGCGGGCACTTGG - Intergenic
935265423 2:101389534-101389556 TGCTGCCAGGGGCTGGGGGGAGG - Intergenic
938451572 2:131425431-131425453 GGCGGCGAGGAGCGGGCGCGGGG - Intergenic
938796121 2:134719183-134719205 TGGGGGCAGGTGCGGGCGGCAGG + Intergenic
938818901 2:134933470-134933492 AGCAGCCAGGAGTGGGCAGGAGG + Intronic
942454801 2:176130329-176130351 GGCGGCCCCGGGCGGGCGGGCGG - Exonic
942458324 2:176152449-176152471 TGCGCCGGGGAGAGGGCGGGAGG + Intronic
944221866 2:197310955-197310977 GGCGGCCCGGTGCGGGCGCGGGG - Intronic
947739950 2:232480477-232480499 TGGGTCCAGGAGCGGGGTGGAGG + Intronic
947810585 2:233001462-233001484 TGAGCCCAGGAGTGGGCTGGAGG + Intronic
948342429 2:237265116-237265138 GGAGCCCAGGAGCGGGCTGGAGG - Intergenic
948459087 2:238120563-238120585 GGCGCCCAGGCGCGGGCAGGAGG - Intronic
948911985 2:241009443-241009465 TGAGGCAAGGAGCAGGCGGCAGG + Intronic
949060080 2:241951902-241951924 GGCTGCCAGGAGCTGGCAGGAGG - Intergenic
949065222 2:241986218-241986240 GGTGGACAGGAGCGGGGGGGTGG + Intergenic
1172421991 20:34825582-34825604 GGCGGCCGGGCGCGGGCGGCGGG - Intronic
1173191104 20:40876160-40876182 TGCGGCCAGGTGCTGGAAGGAGG + Intergenic
1173836370 20:46128721-46128743 TGTGGCCAGCAGGGGGCAGGAGG + Intronic
1174126078 20:48307548-48307570 TGCCTCCTGGAGCGGGAGGGGGG + Intergenic
1175248867 20:57597121-57597143 TGCGGCCAGCAGAGGGCGCTCGG + Intergenic
1176221032 20:63969526-63969548 TGGGGCCGGGAGCGGGCGCGGGG + Intronic
1179251330 21:39673817-39673839 TGGAGCCAGGAGGGTGCGGGAGG - Intergenic
1180132479 21:45835450-45835472 TGCGGCCAGGAGCTGACGGCCGG - Intronic
1180852767 22:19029760-19029782 GGCGGCCGGGCGCGGGCGAGAGG + Intergenic
1181000756 22:19986899-19986921 TGGGGCCAGGGCCGGGCGGGTGG - Intronic
1181162617 22:20967148-20967170 TGTGGCCAGGAGGGGCTGGGGGG - Intronic
1181162889 22:20968118-20968140 TGCCGCCAGGAGGGGGTAGGGGG + Intronic
1182254860 22:29030941-29030963 TGGAGCGAGGAGCCGGCGGGTGG + Intronic
1182294902 22:29306974-29306996 TCCTGCCCGGAGGGGGCGGGCGG - Intronic
1182638766 22:31750246-31750268 TGGGGCTAGCAGAGGGCGGGAGG - Intergenic
1183301434 22:37060967-37060989 TCCAGCAAGGAGTGGGCGGGAGG - Intronic
1183504513 22:38201902-38201924 TCCGGCCAGGAGCGGCCGCTTGG - Exonic
1183912794 22:41091968-41091990 TGCGGACGGGAGGGGGCTGGGGG - Exonic
1184101574 22:42343937-42343959 CGCGGGCGGGGGCGGGCGGGCGG + Intergenic
1184230624 22:43156527-43156549 GGCGGCCAGGGGTGGGAGGGAGG + Intronic
1184663384 22:45975786-45975808 CGGGGCCAGCAGCGGGCGGTGGG + Intronic
1185048911 22:48543556-48543578 TGCGGTCAGCAGCGGGCCTGAGG - Intronic
1185228740 22:49668185-49668207 TGGGGCGAGGGGGGGGCGGGGGG + Intergenic
1185268739 22:49918677-49918699 CGCGGCTGGGAGCGGGTGGGCGG + Exonic
1185333594 22:50262008-50262030 TTAGGACTGGAGCGGGCGGGGGG - Intergenic
1185347499 22:50316964-50316986 GGCGGCGAGGACAGGGCGGGGGG + Intronic
1185347533 22:50317029-50317051 GGCGGCGAGGACAGGGCGGGGGG + Intronic
1185397428 22:50600325-50600347 TGCGGCCCGGAGCGGGGTGGCGG - Intronic
1185413386 22:50697410-50697432 GGCGGCGAGGGGAGGGCGGGAGG + Intergenic
952171352 3:30810708-30810730 TGCGGCCAAGAGAGGACTGGGGG - Intronic
953030650 3:39177756-39177778 CGCGGCCAGGGGCGGGAGGCGGG - Intergenic
953989895 3:47475911-47475933 GGCGGCCAGGAGAGAGAGGGAGG - Exonic
957145993 3:76424488-76424510 TGCTGCCAGGAGCTGGGGGCAGG + Intronic
958837783 3:99166573-99166595 TGGGGCCTGCAGCGGGTGGGAGG - Intergenic
961616315 3:128184350-128184372 GGTGGCCAGGAGCTGGTGGGAGG - Intronic
962520755 3:136195860-136195882 GGCGGGCGGGAGGGGGCGGGGGG + Intronic
964129287 3:153268964-153268986 GGAGGTCAGGAGCGGGTGGGGGG - Intergenic
965757560 3:172040692-172040714 GGCGGCCAGGAGGGGCCGCGCGG + Intronic
966245682 3:177805212-177805234 GGAGGCCAGGAGCGGGGCGGTGG + Intergenic
966866470 3:184261322-184261344 TGCGGCGGGGCGCGGGCGGCGGG + Exonic
968230766 3:197003378-197003400 GGCGGGCGGGAGCAGGCGGGCGG + Exonic
968452914 4:683538-683560 TGAGGCCCGGAGAGGGCGGTTGG - Intronic
968475568 4:805124-805146 CGGGGCCTGGAGCGGGAGGGAGG + Intronic
968556609 4:1249054-1249076 GGCGGCCAGGCGCAGGCGGGCGG - Exonic
968729252 4:2261981-2262003 GGCGGACGGGCGCGGGCGGGAGG - Exonic
969691444 4:8706191-8706213 TGCGGCAAGGGGCAGGAGGGTGG + Intergenic
970195077 4:13544421-13544443 CGCGGGCAGGAGCGGCCGGCGGG + Exonic
971457801 4:26860766-26860788 CGCGGGCCGGAGGGGGCGGGGGG + Intronic
972232104 4:37085620-37085642 GGTGGCCAGGAGCCGGCAGGTGG + Intergenic
975118508 4:70704979-70705001 TGCAGCGAGGAGCCGGCGAGGGG + Intronic
976765405 4:88592882-88592904 GGCGGCCGAGCGCGGGCGGGAGG - Intronic
977065315 4:92305688-92305710 GGCGAGCAGGGGCGGGCGGGGGG + Intronic
977536533 4:98261303-98261325 CGCGGCTCCGAGCGGGCGGGCGG - Intergenic
980541495 4:134201690-134201712 GGCGGCCAGGCGGGGGCTGGGGG + Intronic
981033970 4:140152082-140152104 AGCGGCCTGGAGGGGGCGGGAGG - Intronic
981315422 4:143336288-143336310 GGCGGCCGGGAGAGGGAGGGAGG + Intergenic
982702354 4:158671472-158671494 TGCGCCCCAGAGCGTGCGGGCGG - Intronic
982712160 4:158768828-158768850 TGCGGCCAGGAGCGGGCGGGCGG - Intergenic
984668072 4:182449106-182449128 GGCGGCCTGGGGCGGGCTGGCGG + Intronic
984908289 4:184649494-184649516 GGCCGACAGGGGCGGGCGGGAGG - Intronic
985512122 5:318815-318837 TGTGGCCAGGAGAGGACAGGAGG + Intronic
985771658 5:1815561-1815583 AGCGGCCTGGAGCAGGCGGTGGG - Intronic
985783533 5:1882654-1882676 CGCGGCCCGGGGCGGACGGGCGG + Exonic
988595451 5:32586048-32586070 TGCGGGCGGGAGGGGGCCGGGGG + Intronic
989812564 5:45695855-45695877 GGCGGCGAGGAGCCGGCGGGGGG - Exonic
991298262 5:65103369-65103391 GGCGGCCAGGTGGGGGCGGCGGG - Intergenic
992080879 5:73233688-73233710 TGCGCTCGGGAGCGTGCGGGTGG - Intergenic
994072842 5:95620891-95620913 CCCGGCCAGGCGCGGGCGGCCGG - Exonic
996290983 5:121852094-121852116 TGCGGCCAGGGGGCGGCGGGGGG - Exonic
997521779 5:134527710-134527732 TGCCTCCAGGGGCGGGCTGGAGG + Intronic
997635051 5:135398785-135398807 AGCGCCCAGGCGCGGGCAGGGGG + Intronic
1000614923 5:163415908-163415930 TGCGGGGAGGAGAGGACGGGTGG + Intergenic
1001241074 5:170070164-170070186 GGAGGGCAGGAGCTGGCGGGAGG + Intronic
1002927856 6:1615070-1615092 TGCGGCCAGGCCGAGGCGGGTGG - Intergenic
1003107360 6:3226997-3227019 GCCCGCCAGGAGCGGGTGGGCGG + Intronic
1004561560 6:16757757-16757779 TGGGGCAGGGGGCGGGCGGGGGG - Intronic
1005670849 6:28104898-28104920 CTCAGCCAGGTGCGGGCGGGAGG + Intergenic
1007392845 6:41560557-41560579 CGCGCCCAGGAGCGCGCTGGGGG + Intronic
1007722177 6:43891557-43891579 GGCGCCCAGGGCCGGGCGGGAGG + Intergenic
1007740761 6:44008227-44008249 TGAGGCAAGGAGTGGGCTGGGGG + Intergenic
1007785362 6:44276556-44276578 TCCGGCGAGGGGCAGGCGGGAGG - Exonic
1008013371 6:46491392-46491414 TGCGGGGAGGAGCGGGCAGCAGG - Intronic
1008569225 6:52799193-52799215 TGCAGCCAGGAGCCACCGGGTGG + Exonic
1008629283 6:53348408-53348430 TGCGGGCCGGAGCGCGCGGCGGG - Intronic
1012896346 6:104953796-104953818 TGCGGGGAGGAGAGGACGGGTGG + Intergenic
1013048932 6:106512782-106512804 TGCGGCCGAGAGCGGGGAGGAGG + Exonic
1013175015 6:107669339-107669361 TGCGGCCAGCAGCGCACGGCAGG - Intergenic
1013600644 6:111701340-111701362 GGCTGCCAGGAGGGAGCGGGAGG - Intronic
1015493499 6:133855063-133855085 TGGGGCCAGGAGCAGGTGGGAGG - Intergenic
1015663590 6:135603101-135603123 TGGGCCCAGGAGCAGGCGGGAGG + Intergenic
1016563126 6:145419182-145419204 TGGGGAAAGGAGCGGGGGGGGGG - Intergenic
1017717160 6:157221074-157221096 TGTGGCCAGGAGCCGGCCAGGGG - Intergenic
1018907176 6:168082390-168082412 TTCAGCCAGGAGGGGTCGGGTGG - Intergenic
1019428349 7:987668-987690 TCCAGCCAGGAGCAGGAGGGAGG + Intronic
1019474638 7:1238196-1238218 TGCGGGCAGGGGCGGGGGCGCGG - Intergenic
1019737983 7:2659847-2659869 TGGGGCCAGGAGTGGGCTGTGGG - Intronic
1020204654 7:6105229-6105251 AGCGGCCTGGCCCGGGCGGGCGG - Intronic
1020235046 7:6348786-6348808 CGCGGCGCGGAGAGGGCGGGCGG - Exonic
1021719250 7:23490441-23490463 GGCGGGCGGGCGCGGGCGGGCGG + Intergenic
1022088143 7:27088435-27088457 GGCTGCGGGGAGCGGGCGGGGGG - Intergenic
1022410367 7:30135084-30135106 GGCGCCTAGGAGCGGGAGGGCGG + Exonic
1023810364 7:43906661-43906683 CGCGTCCCGGAGCGGGCGGGCGG - Exonic
1024920182 7:54546419-54546441 TGGGGCCAGGAGCGCGGGGCGGG + Intronic
1025615559 7:63113824-63113846 TGCGGGCAGGACCGGGTGGGGGG + Intergenic
1026837373 7:73647807-73647829 CGCGGCCAGGGGCGGGCGGCGGG + Intergenic
1026941253 7:74289356-74289378 CGGGGCCTGGGGCGGGCGGGAGG - Intergenic
1029659021 7:101946647-101946669 TGAGGCCAGGAGCTGGTGGAGGG + Intronic
1029813889 7:103074895-103074917 CGCTGCCAGGGGCGGGAGGGAGG + Exonic
1031602055 7:123722008-123722030 TGGGGGCAGGGGCAGGCGGGAGG + Intronic
1031629862 7:124033085-124033107 AGCGGCCAGGAGGCGGCGCGGGG - Intergenic
1031746659 7:125506533-125506555 TGCTGCCAGGGGCGGGGGAGGGG + Intergenic
1032194047 7:129779758-129779780 TGGGGCCGGGAGCGGGGGGGCGG - Intergenic
1033582362 7:142749555-142749577 GTCGGCCAGGAACGGGGGGGTGG - Intronic
1033732829 7:144195639-144195661 GGCGGCCAGGGGCGGGCCGCGGG - Exonic
1033750222 7:144355378-144355400 GGCGGCCAGGGGCGGGCCGCGGG + Exonic
1034413112 7:150951420-150951442 TGTGCCCAGGGGCGGGCGGCGGG - Intronic
1034493880 7:151409185-151409207 TGCGGCCGGGATCGGGTGGGTGG - Intronic
1034620283 7:152451661-152451683 TGCGGCGGGGGGCGGGGGGGGGG - Intergenic
1034880347 7:154757969-154757991 GGCGGCGGGGAGAGGGCGGGGGG - Intronic
1035050881 7:155998546-155998568 TGTGGCCAGGCGGGGGCGCGGGG - Intergenic
1035277519 7:157757005-157757027 TGGGGCCAGGAGCCGCCGTGTGG + Intronic
1044675011 8:94719893-94719915 GGCGGCCAGGAGCGGGCCCCCGG + Exonic
1044832933 8:96267875-96267897 TGTGGGCAGGAGGTGGCGGGAGG - Intronic
1045488594 8:102654073-102654095 TGCGGCCCGGGGCGGGGGCGTGG + Intronic
1048251147 8:132867772-132867794 TGCGGCAGGGTGGGGGCGGGCGG + Intronic
1049398455 8:142412767-142412789 TGCCGCCAGGTGCGGGGTGGGGG + Intergenic
1049697274 8:143990389-143990411 GGCGGCCTGGAGCCGGAGGGAGG + Intronic
1049796773 8:144500604-144500626 TGGGGCCAGGTGAGTGCGGGCGG + Exonic
1049796779 8:144500618-144500640 TGCGGGCGGGAGCAGGTGGGAGG + Intronic
1051079365 9:13278411-13278433 AGTGGCCAGGCGCCGGCGGGAGG - Intronic
1052264607 9:26557513-26557535 TGCTGCCAGGGGCTGGGGGGAGG + Intergenic
1053009186 9:34623801-34623823 TTCGGCCTGGGGCGGGAGGGGGG - Intronic
1053471957 9:38352943-38352965 TGCCGCCTGGAGCGGGAGGCTGG - Intergenic
1056799504 9:89681417-89681439 TGGGGCCCGGGGGGGGCGGGGGG - Intergenic
1057294651 9:93828063-93828085 GGCGGCCCAGGGCGGGCGGGCGG + Intergenic
1059414640 9:114155454-114155476 GGCGGCCGGGAGCGGGGAGGAGG + Intergenic
1060477945 9:123999680-123999702 TGCGGCCGGGGGCGGGGGCGGGG - Intergenic
1060587594 9:124796078-124796100 AGCTGCCAGGAGCGGGCGTGGGG + Intronic
1060951746 9:127608440-127608462 TGCGGAGAGGAGCGGGGGAGAGG - Intergenic
1061445410 9:130634556-130634578 TGTGGCCAGGAGCGAGGTGGAGG + Intronic
1061859249 9:133459796-133459818 TGCGGCGAGGAGCTGGGGGTGGG - Intergenic
1061874650 9:133537596-133537618 AGCGGGCAGGAGAGGGCGGTTGG + Intronic
1061924304 9:133798420-133798442 TGGGGCCAGGAGGAGGCGGTGGG - Intronic
1061959090 9:133978999-133979021 TGGGGTCAGGAGCTGGCTGGAGG - Intronic
1061975076 9:134063958-134063980 TGCGGCAAGGAGGGGGGCGGGGG + Intronic
1062027638 9:134347805-134347827 GGTGGCCAGGAGGGGGCTGGTGG + Intronic
1062333008 9:136052757-136052779 CGCAGCCAGGAGTGTGCGGGAGG - Intronic
1062349778 9:136133128-136133150 TGGGGGCAGGAGCGGGGGTGGGG - Intergenic
1062393736 9:136344197-136344219 CGCGGACAGGAGCGGGGTGGGGG + Intronic
1062473181 9:136715059-136715081 TGTGGCCAGGCGCTGCCGGGAGG + Intronic
1062516853 9:136941199-136941221 TGTGGGCAGCAGCGGGCGGGCGG - Intronic
1062582756 9:137235747-137235769 AGCTCCCAGGAGCGTGCGGGAGG + Intronic
1202628894 M:306-328 TGTGGCCAGAAGCGGGGGAGGGG - Intergenic
1185445564 X:256137-256159 TGCGGGAATGAGCGTGCGGGGGG - Intergenic
1186636869 X:11415655-11415677 TGTGGCCAGTAGCAGGTGGGTGG + Intronic
1187055399 X:15737927-15737949 TGCGGCCAGCGGCGAGCAGGAGG + Intronic
1187648374 X:21374329-21374351 CGCGGCAGCGAGCGGGCGGGGGG + Intergenic
1200061891 X:153487476-153487498 TGGGGCCAGGAATGGGGGGGAGG - Intronic
1200138100 X:153884764-153884786 TGCAGCAAGGAGCTGACGGGAGG + Intronic