ID: 982712160

View in Genome Browser
Species Human (GRCh38)
Location 4:158768828-158768850
Sequence TGCGGCCAGGAGCGGGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712160_982712181 20 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA No data
Right 982712181 4:158768871-158768893 GCCGGGGTTACGTGAGCCCGGGG No data
982712160_982712170 3 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA No data
Right 982712170 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG 0: 1
1: 1
2: 10
3: 137
4: 916
982712160_982712168 2 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA No data
Right 982712168 4:158768853-158768875 TCCCACCTCCCGCCTCCCGCCGG No data
982712160_982712185 27 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA No data
Right 982712185 4:158768878-158768900 TTACGTGAGCCCGGGGCGGGCGG No data
982712160_982712184 24 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA No data
Right 982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG No data
982712160_982712172 4 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA No data
Right 982712172 4:158768855-158768877 CCACCTCCCGCCTCCCGCCGGGG No data
982712160_982712179 18 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA No data
Right 982712179 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG No data
982712160_982712180 19 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA No data
Right 982712180 4:158768870-158768892 CGCCGGGGTTACGTGAGCCCGGG No data
982712160_982712183 23 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA No data
Right 982712183 4:158768874-158768896 GGGGTTACGTGAGCCCGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712160 Original CRISPR TGCGGCCAGGAGCGGGCGGG CGG (reversed) Intergenic