ID: 982712162

View in Genome Browser
Species Human (GRCh38)
Location 4:158768832-158768854
Sequence GAGGTGCGGCCAGGAGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 393}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712162_982712168 -2 Left 982712162 4:158768832-158768854 CCGCCCGCTCCTGGCCGCACCTC 0: 1
1: 0
2: 2
3: 34
4: 393
Right 982712168 4:158768853-158768875 TCCCACCTCCCGCCTCCCGCCGG No data
982712162_982712172 0 Left 982712162 4:158768832-158768854 CCGCCCGCTCCTGGCCGCACCTC 0: 1
1: 0
2: 2
3: 34
4: 393
Right 982712172 4:158768855-158768877 CCACCTCCCGCCTCCCGCCGGGG No data
982712162_982712186 30 Left 982712162 4:158768832-158768854 CCGCCCGCTCCTGGCCGCACCTC 0: 1
1: 0
2: 2
3: 34
4: 393
Right 982712186 4:158768885-158768907 AGCCCGGGGCGGGCGGCCGCCGG No data
982712162_982712179 14 Left 982712162 4:158768832-158768854 CCGCCCGCTCCTGGCCGCACCTC 0: 1
1: 0
2: 2
3: 34
4: 393
Right 982712179 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 30
982712162_982712184 20 Left 982712162 4:158768832-158768854 CCGCCCGCTCCTGGCCGCACCTC 0: 1
1: 0
2: 2
3: 34
4: 393
Right 982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG No data
982712162_982712181 16 Left 982712162 4:158768832-158768854 CCGCCCGCTCCTGGCCGCACCTC 0: 1
1: 0
2: 2
3: 34
4: 393
Right 982712181 4:158768871-158768893 GCCGGGGTTACGTGAGCCCGGGG No data
982712162_982712185 23 Left 982712162 4:158768832-158768854 CCGCCCGCTCCTGGCCGCACCTC 0: 1
1: 0
2: 2
3: 34
4: 393
Right 982712185 4:158768878-158768900 TTACGTGAGCCCGGGGCGGGCGG No data
982712162_982712183 19 Left 982712162 4:158768832-158768854 CCGCCCGCTCCTGGCCGCACCTC 0: 1
1: 0
2: 2
3: 34
4: 393
Right 982712183 4:158768874-158768896 GGGGTTACGTGAGCCCGGGGCGG No data
982712162_982712170 -1 Left 982712162 4:158768832-158768854 CCGCCCGCTCCTGGCCGCACCTC 0: 1
1: 0
2: 2
3: 34
4: 393
Right 982712170 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG 0: 1
1: 1
2: 10
3: 137
4: 916
982712162_982712180 15 Left 982712162 4:158768832-158768854 CCGCCCGCTCCTGGCCGCACCTC 0: 1
1: 0
2: 2
3: 34
4: 393
Right 982712180 4:158768870-158768892 CGCCGGGGTTACGTGAGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712162 Original CRISPR GAGGTGCGGCCAGGAGCGGG CGG (reversed) Intergenic
900237677 1:1600302-1600324 GGGGTGCGGGCAGGGGCGCGGGG + Intergenic
900320830 1:2082830-2082852 GAGGGGCGGCCAAGGGCGTGAGG + Intronic
900386650 1:2413745-2413767 GAGGTGAGGCAAGGAACTGGAGG - Intronic
900391143 1:2434512-2434534 CAGCTGCCGCCAGGTGCGGGCGG + Intronic
901016728 1:6236104-6236126 GAGGGGCGGGGAGGGGCGGGCGG - Intergenic
901045380 1:6393022-6393044 GAGATGCGGCCAGGAGGAGCCGG + Intronic
901543391 1:9936842-9936864 CAGCTGCGGCCAGGCGCCGGTGG + Intronic
901702869 1:11054777-11054799 GAGGTCCGGCCCGGGGCTGGAGG + Exonic
901741184 1:11343025-11343047 GAGGTGGGGAGAGGAGCAGGAGG + Intergenic
902286473 1:15411098-15411120 GTGGGGCGGGCAGGAGCGGGAGG - Intronic
903334897 1:22618333-22618355 GACGACCAGCCAGGAGCGGGAGG + Intergenic
904033314 1:27546587-27546609 TAGGTGTGGCCAGGAGCATGTGG - Intronic
904317187 1:29673161-29673183 GAGCTGCGTCCAGGCCCGGGTGG - Intergenic
904620464 1:31772062-31772084 GCCGCGCGGCCGGGAGCGGGCGG + Intergenic
905137128 1:35808357-35808379 GCGGCGGGGCCCGGAGCGGGAGG + Exonic
905300394 1:36982776-36982798 GAGCTGAGGCCGGGAGAGGGAGG + Intronic
905714031 1:40132851-40132873 GAGGAGCGGCCTGGTGCGGCTGG - Intergenic
905868083 1:41387098-41387120 GAGGTGGTGCCAGGAGAGGATGG + Intergenic
906109091 1:43311675-43311697 GAGGTGCAGCCAGGGGCACGGGG - Exonic
906689041 1:47780667-47780689 GAGGTGAGGATAGGAGTGGGTGG + Intronic
907269243 1:53280985-53281007 GAGGTGTGGCCAGGAGGGGCAGG - Intronic
908815010 1:68022817-68022839 GAGGACAGGCCAGGAGCTGGAGG - Intergenic
910848595 1:91628127-91628149 GAGAAGCGGCCAGGTGCGGTGGG + Intergenic
912429086 1:109619810-109619832 GAGGCGGGGCCAGGCGGGGGCGG + Intronic
912626836 1:111212580-111212602 GTGGTGGGGGCAGGGGCGGGGGG - Intronic
913199426 1:116484057-116484079 GATGTGGGGGCAGGAGGGGGAGG + Intergenic
914950707 1:152111008-152111030 GAGGCGCCGCCAAGAGCAGGAGG - Exonic
915310513 1:155003887-155003909 GAGGTGGGGGCGGGAGTGGGGGG + Intronic
915368132 1:155326725-155326747 GAGGTGGGCCCAGGGGCAGGTGG - Exonic
915524236 1:156466451-156466473 GAGGTGGGGTCAGGAGCAGAAGG + Exonic
915595318 1:156893653-156893675 GAGGGGCGCCGAGGGGCGGGGGG - Intergenic
916750889 1:167722030-167722052 GAGGTGCCACCCGGCGCGGGTGG + Exonic
916875471 1:168964054-168964076 GAGGGGTGGGCAGGAGGGGGTGG - Intergenic
917821387 1:178767699-178767721 GAGGCCAGGCCAGGAGTGGGTGG + Intronic
920051748 1:203168552-203168574 GAGAGGAGGCCAGGAGCAGGGGG - Intronic
920804042 1:209216515-209216537 GGGGAGTGGCAAGGAGCGGGAGG - Intergenic
921299910 1:213742055-213742077 GAGGAATGGCCAGGAGGGGGTGG + Intergenic
922287639 1:224183588-224183610 GAGGCTGGGCGAGGAGCGGGGGG + Intronic
922513185 1:226186584-226186606 GAGGAGCGGCCTGGGGCGGAGGG - Exonic
922606570 1:226893331-226893353 CAGCTGGGGCCAGGAGCAGGAGG + Intronic
1064420831 10:15189418-15189440 GAAGTGAGCCCAGGAGTGGGAGG - Intergenic
1065047456 10:21757237-21757259 GAGGTGGGGCCAGGAGGAGCAGG - Intronic
1067300279 10:45001251-45001273 GAGGCGCGGCCCGCGGCGGGTGG + Intronic
1067669460 10:48306435-48306457 GGGGCGTGGCCTGGAGCGGGAGG - Intergenic
1067804689 10:49384661-49384683 CTGGTGCGGACAGGAGGGGGTGG - Intronic
1068839016 10:61589401-61589423 GAGATGGGGCCAGGAGGTGGAGG + Intergenic
1069513052 10:69056494-69056516 GAGGGGCAGCAAGGAGCTGGCGG - Intergenic
1071598875 10:86946570-86946592 GTGGTGGTCCCAGGAGCGGGGGG + Intronic
1072619149 10:97068274-97068296 GATGTATGGCCAGGAGGGGGAGG - Intronic
1072994276 10:100229495-100229517 GGGCTGCGGCCGGGCGCGGGCGG - Exonic
1073191865 10:101657087-101657109 GAGGTGCTGACAAGGGCGGGAGG - Intronic
1073205910 10:101769217-101769239 GAGGTGCGGTGAGGAGCCTGGGG - Intergenic
1074868542 10:117559426-117559448 GAGGAGCGGCCAGGTACTGGAGG - Intergenic
1075112479 10:119598204-119598226 GGGATGCGGGCGGGAGCGGGGGG + Intergenic
1075573335 10:123560705-123560727 GAGGTGGGGCCAGGAGCCCAGGG + Intergenic
1076562468 10:131376124-131376146 GATGAGGGGGCAGGAGCGGGAGG + Intergenic
1076676411 10:132149667-132149689 GAGGTGGGGCAGGGAGGGGGTGG - Intronic
1076816544 10:132917918-132917940 GAGGTGCGTCGTGGAGAGGGGGG - Intronic
1076816552 10:132917953-132917975 GAGGTGCGTCGTGGAGAGGGGGG - Intronic
1076816560 10:132917988-132918010 GAGGTGCGTCGTGGAGAGGGGGG - Intronic
1076816568 10:132918023-132918045 GAGGTGCGTCGTGGAGAGGGGGG - Intronic
1076816576 10:132918058-132918080 GAGGTGCGTCGTGGAGAGGGGGG - Intronic
1076816584 10:132918093-132918115 GAGGTGCGTCGTGGAGAGGGGGG - Intronic
1076816592 10:132918128-132918150 GAGGTGCGTCGTGGAGAGGGGGG - Intronic
1076816600 10:132918163-132918185 GAGGTGCGTCGTGGAGAGGGGGG - Intronic
1076816608 10:132918198-132918220 GAGGTGCGTCGTGGAGAGGGGGG - Intronic
1076816616 10:132918233-132918255 GAGGTGCGTCGTGGAGAGGGGGG - Intronic
1076816624 10:132918268-132918290 GAGGTGCGTCGTGGAGAGGGGGG - Intronic
1076816638 10:132918338-132918360 GAGGTGCGTCGTGGAGAGGGGGG - Intronic
1076816646 10:132918373-132918395 GAGGTGCGTCATGGAGAGGGGGG - Exonic
1076908770 10:133377268-133377290 GAGGTGAGGCCAGGTGCCTGGGG + Intergenic
1077107861 11:849736-849758 GCGGTGCGGCGAGGAGGGGAGGG + Intronic
1077898773 11:6473876-6473898 GAGGCGCGGGCAGGGCCGGGCGG - Intronic
1078064164 11:8067029-8067051 GTGGAGCTGCCTGGAGCGGGAGG - Intronic
1080896128 11:36450062-36450084 TGGGTGCGGCCAGGGGCTGGGGG - Intronic
1081644621 11:44781086-44781108 GAGGAGCAGCCAGGAACTGGTGG + Intronic
1081740089 11:45433045-45433067 GAGGCGCGGCCTGGGGCTGGAGG + Intergenic
1081792605 11:45798997-45799019 GATGTGTGGCCAGAAACGGGGGG - Intergenic
1081867416 11:46367312-46367334 GAGGGGGGGCCAGGTGCTGGAGG - Exonic
1083310341 11:61780624-61780646 GAGGTGGCCCCAGGAGCTGGGGG - Intronic
1083571189 11:63763083-63763105 GGGGTGCGGCCGGGAGCGCTCGG + Exonic
1083869683 11:65479086-65479108 GTCGTGCGGCCAGGCGCGGGTGG + Intergenic
1083970508 11:66071007-66071029 GTGGGGCTGCCAGGAGAGGGCGG - Intronic
1084372138 11:68751236-68751258 GAGGAGCAGCCAGGGGAGGGGGG + Intronic
1084500981 11:69535003-69535025 GTGGTGGGGTCAGGAGCTGGGGG + Intergenic
1084789006 11:71461826-71461848 GAGGTGGGGCCTGGTGGGGGCGG - Intronic
1084979498 11:72821744-72821766 GAGGCGCGGGCGGGGGCGGGAGG + Intronic
1085400060 11:76230516-76230538 GAGGTGTGGCCATGAGGGGCTGG - Intergenic
1085666163 11:78417498-78417520 GAGGAGCGGCCGGGGGCGTGTGG - Intronic
1089124144 11:116164501-116164523 CAGGTGGGGGCAGGAGCTGGAGG + Intergenic
1090278454 11:125435906-125435928 GAGATGCGGGCAGGTGGGGGCGG - Intergenic
1090636274 11:128692386-128692408 GAGAAGCAGACAGGAGCGGGGGG + Intronic
1090699102 11:129278973-129278995 GAGATGGGGCCGGGGGCGGGGGG + Intronic
1091174757 11:133547948-133547970 GGGATGCAGGCAGGAGCGGGCGG - Intergenic
1091443709 12:531013-531035 GAGGTCTGGCTAGGAGCAGGAGG + Intronic
1091656092 12:2347932-2347954 GAAGAGGGGCCAGGAGCGGGAGG + Intronic
1096537711 12:52286116-52286138 AATGTGAGGCCAGGAGTGGGAGG + Exonic
1096869573 12:54584883-54584905 GAGCTGGGGCCAGGACCAGGGGG - Intronic
1098161154 12:67649035-67649057 GAGGGGCGGCCGGGAGGCGGCGG + Exonic
1100425537 12:94482146-94482168 CAGGTGTGGCCAGGTGGGGGCGG + Intergenic
1101719123 12:107335783-107335805 GAGGTAGGGCCAGGAGGGGAGGG + Intronic
1102178386 12:110893148-110893170 GAGGTGAGAACAGGATCGGGAGG + Exonic
1102455029 12:113065780-113065802 GAGGAGGGGCCAGGACGGGGAGG + Intronic
1102923914 12:116812467-116812489 TAGGTGAGGCCAGGAGGTGGCGG + Intronic
1103826752 12:123745127-123745149 GAGGGGAGGCCAGGAGCTGGGGG + Intronic
1103899265 12:124295086-124295108 GAGGTGCGGAGAGGGCCGGGCGG + Intronic
1104604916 12:130180772-130180794 GAGATGAGGCCAGGAGAGTGGGG - Intergenic
1104724363 12:131066826-131066848 GAGGAGCGGCCAGGAGGCCGAGG + Intronic
1104794984 12:131511097-131511119 GAAGTGCACCCAGGAGCAGGTGG - Intergenic
1104854314 12:131894916-131894938 GAGGCGCGGGCCGGGGCGGGCGG - Exonic
1104955238 12:132461605-132461627 GAGGGGCCGCCAGGAGCCTGGGG + Intergenic
1104968901 12:132522328-132522350 GACGTGCAGCCTGGAGCTGGGGG + Intronic
1105900534 13:24748022-24748044 CAGGTCCAGCCCGGAGCGGGAGG - Intergenic
1107655557 13:42589387-42589409 GCAGTGAGGCCAGGAGGGGGTGG - Intronic
1107787114 13:43968606-43968628 GAGGGGGGGCCAGGTGCTGGAGG - Intergenic
1111396213 13:87672393-87672415 GAGGGGAGGCACGGAGCGGGAGG - Intergenic
1112216336 13:97434350-97434372 GAGGTGGGGGCGGCAGCGGGAGG + Exonic
1113107620 13:106788510-106788532 CAGGTGTGGTCAGGAGCGAGTGG + Intergenic
1113942319 13:114024736-114024758 GAGGTGGGGCCACGGGAGGGCGG - Intronic
1115557386 14:34554222-34554244 GAGTTGCGGCAAGGGGCAGGTGG + Intergenic
1117307196 14:54488662-54488684 AGGGTGCGGCCACGAGCAGGGGG - Intronic
1117543311 14:56769670-56769692 GAGATGAGGCCAGGAGCTGAGGG - Intergenic
1119875571 14:78056467-78056489 GAGGTGGGGCCTGGTGGGGGGGG + Intergenic
1122861373 14:104584107-104584129 GAGCTGCTGGCAGGAGCTGGGGG + Intronic
1122866268 14:104605318-104605340 CAGGTGTGGGCAGGAGGGGGTGG + Intronic
1122971122 14:105152632-105152654 AAGGTGCTGCCAGGGCCGGGAGG + Intronic
1124629425 15:31328110-31328132 GCGGCGCGGGCAGGTGCGGGCGG + Intronic
1125448366 15:39782565-39782587 GCGGTGCGCCGAGGAGTGGGCGG - Intronic
1127262152 15:57334472-57334494 GAGGGGAAGCCAGGAGAGGGAGG + Intergenic
1127326036 15:57896258-57896280 GAGGTGCGGCGGGGGGGGGGGGG - Intergenic
1128460004 15:67859831-67859853 GAGGTGCTTCCAGGAGGTGGCGG + Intergenic
1128506645 15:68277730-68277752 GAGGAGAGGGCGGGAGCGGGAGG - Intergenic
1131184780 15:90265259-90265281 TAGGTGCGGCCCGGGGCTGGAGG + Intronic
1131911953 15:97215874-97215896 GAGGAGTGGCCAGGAGCTGAAGG - Intergenic
1132055492 15:98648272-98648294 GCGGTGGGGGCGGGAGCGGGTGG + Intergenic
1132185128 15:99797274-99797296 CAGGTGCAGACAGGAGAGGGAGG - Intergenic
1132431860 15:101767281-101767303 CAGGTGCAGACAGGAGAGGGAGG + Intergenic
1132560219 16:590117-590139 GAGGTGCGCCCGGGCGCGGGCGG + Intronic
1132746319 16:1437797-1437819 GAGGTGCGCCAGGCAGCGGGCGG - Exonic
1133102337 16:3486973-3486995 GAGGTGCAGCCAGGCGGGTGCGG - Intergenic
1133249205 16:4469235-4469257 GAGCTGCAGCCAGGAGCAGGAGG - Exonic
1133771303 16:8868594-8868616 GCGGTGGGGCGAGGCGCGGGGGG - Intronic
1135772960 16:25231296-25231318 CAGGAGCCGCCAGGAGCAGGGGG + Intergenic
1137626908 16:49914824-49914846 GAGGTGGGGGGAGGGGCGGGCGG + Intergenic
1139930762 16:70524193-70524215 GAGGTGTGACAAGCAGCGGGAGG + Intronic
1140321298 16:73954369-73954391 GATGTGCTGCCTGGAGTGGGAGG - Intergenic
1141116680 16:81315311-81315333 GCGGTGCTGCCCGGAGCCGGAGG + Intronic
1141386012 16:83623189-83623211 GAGGTGGGGCCAGGGCTGGGTGG + Intronic
1141502393 16:84453067-84453089 GAGGTGGGGCCGGGAGTGAGGGG + Intronic
1141562418 16:84878347-84878369 GGGGTGTGGCCGGGAGCTGGAGG - Intronic
1141608673 16:85169514-85169536 GCGGCGCGGCCATGAGCGGGCGG + Intergenic
1141836858 16:86546371-86546393 GGGCTGGGGCCAGAAGCGGGTGG + Intronic
1142178403 16:88655636-88655658 CGGGTAAGGCCAGGAGCGGGTGG - Exonic
1143503393 17:7351541-7351563 GAGGTGCGGGGAGCAGCTGGGGG + Intergenic
1143627080 17:8116772-8116794 GAGCTGAGGCCAGGAACAGGTGG - Exonic
1143731584 17:8885451-8885473 GAGGTGGGGCCATGGGAGGGCGG - Intronic
1143731651 17:8885615-8885637 GAGGTGGGGCCATGGGGGGGCGG - Intronic
1143731690 17:8885697-8885719 GAGGTGGGGCCATGGGAGGGCGG - Intronic
1143731705 17:8885730-8885752 GAGGTGGGGCCATGGGAGGGCGG - Intronic
1143731735 17:8885796-8885818 GAGGTGGGGCCATGGGAGGGCGG - Intronic
1143936013 17:10484887-10484909 GAGGTGGGGCCTGGTGGGGGAGG - Intergenic
1144098430 17:11922792-11922814 GAGGTGTGGCCAGTAGGGGCAGG - Intronic
1144222724 17:13114677-13114699 GCCGTGAGGCCAGGAGAGGGCGG + Intergenic
1144454068 17:15404610-15404632 GAGCTGGGGCCAGGGGAGGGAGG + Intergenic
1144816512 17:18039248-18039270 GAGGCGCGGCGTGGAGGGGGCGG - Intergenic
1145266327 17:21381221-21381243 CAGGTGAGGGCAGGAGAGGGAGG - Intronic
1145934110 17:28705117-28705139 GAGGGGCAGGCAGGAGCTGGTGG - Intronic
1146955042 17:36932620-36932642 GGGGTGGGGCAGGGAGCGGGTGG - Intergenic
1147183638 17:38702302-38702324 GAGGTGCGGGCCGGCGCGGTCGG + Intergenic
1147402864 17:40191547-40191569 GAGGCGGGGTCAGGGGCGGGCGG - Intronic
1147462428 17:40581928-40581950 GAGGTGGGGGCAGGAGTGAGAGG - Intergenic
1147567652 17:41547560-41547582 GAGGTGTGGACAGGAGCAGCAGG - Intergenic
1147661833 17:42121083-42121105 GTGGGGGGGCCGGGAGCGGGGGG - Exonic
1148356563 17:46979277-46979299 GAGGGGCGGCCAGGCGCGCGAGG - Intronic
1148384197 17:47222520-47222542 GGGGTGGGCCCAGGAGCTGGAGG + Intronic
1149339484 17:55670946-55670968 GAGGTGCTGCCAAGAGCTGTGGG + Intergenic
1149667745 17:58377680-58377702 GTGGTGGGGGCAGGAGGGGGTGG - Intronic
1151120602 17:71788789-71788811 GAGGTGGGGCCTGGTGGGGGGGG - Intergenic
1151383822 17:73743195-73743217 GAGGGGCAGCCAAGGGCGGGAGG - Intergenic
1151727843 17:75894856-75894878 GTGCTGCCGCCAGGAGCAGGAGG - Intronic
1151945283 17:77316261-77316283 GAGGTAAGGCCAGCAGAGGGTGG - Intronic
1152049246 17:77959283-77959305 CGGCTGCGGCGAGGAGCGGGCGG - Intergenic
1152217897 17:79045095-79045117 GAGGCAGGGCCAGGAGAGGGAGG + Intronic
1152375286 17:79915701-79915723 GAGGTGGGGCCAGGGGCTGGAGG + Intergenic
1152389022 17:79991995-79992017 GAGGTCCGGCGAGGATGGGGGGG - Intronic
1152638499 17:81439877-81439899 GAGGGGCAGCCAAGAGAGGGTGG - Intronic
1152696957 17:81802407-81802429 GAGGTGGGGGCAGGAGCTGAGGG + Intergenic
1152722499 17:81929847-81929869 AAGGTGCAGCCTGGGGCGGGAGG - Intergenic
1152722539 17:81929965-81929987 AAGGTGCAGCCTGGGGCGGGAGG - Intergenic
1152801684 17:82333675-82333697 GAGGCGCGGAGAGGGGCGGGCGG - Intronic
1154161030 18:11981210-11981232 GGGGCGCAGCCGGGAGCGGGAGG + Intronic
1158247558 18:55449076-55449098 GAGATGTGGCCAGGAGAGGGTGG - Intronic
1160134915 18:76263663-76263685 GGGGTGCGGGCAGGAGGGGTGGG - Intergenic
1160583324 18:79899876-79899898 GAGGTGCGCCAAGGGGTGGGGGG + Intronic
1160591590 18:79947811-79947833 GAGGGGAAGCCAGGAGTGGGGGG + Intronic
1160711322 19:552489-552511 GGGGAGCGGCCAGGAGCCTGGGG - Intergenic
1160777539 19:862870-862892 GGGGTGTGGCCAGGAGCTGGGGG + Intronic
1160862953 19:1245329-1245351 GGGGTGGGCCCAGGAGGGGGCGG + Intergenic
1160864051 19:1249471-1249493 AGGGAGCGGCCGGGAGCGGGAGG - Intronic
1160906844 19:1455644-1455666 GAGGCGGGGCCAGAAGCTGGAGG + Intronic
1160995604 19:1880763-1880785 CAGGTGGTGCCAGGAGCAGGTGG + Intronic
1161340767 19:3740761-3740783 AAGGTGGGGCCCGGAGCTGGAGG + Exonic
1161346457 19:3770911-3770933 GTGGCGCCGCCAGGAGCGGCTGG - Exonic
1161456664 19:4373091-4373113 GGGATGAGGCCAGGAGGGGGAGG + Intronic
1161686957 19:5707651-5707673 GGGGTGCAGCCAGGCGTGGGGGG + Intronic
1161730143 19:5954940-5954962 GTGCTGAGGCCAGGAGCAGGAGG - Intronic
1161854219 19:6754300-6754322 GCGCTGCGGCCAGGGGCGGCGGG - Exonic
1162109136 19:8390709-8390731 GGGGTGGGGCCCGGAGCGGTGGG + Intronic
1162366428 19:10252308-10252330 CAGGTGAGGCCAGGGGCTGGAGG + Exonic
1162412860 19:10517159-10517181 GTGGCCCGGCCAGGAGGGGGTGG + Intronic
1162451325 19:10756921-10756943 GAGGAGAGGGCAGGAGCAGGAGG - Intronic
1162470945 19:10871721-10871743 GCGGTGGGGCCGGGCGCGGGCGG + Exonic
1162991872 19:14308261-14308283 GAGGTGAGGCCTGAAGTGGGAGG + Intergenic
1163003132 19:14381496-14381518 GAGCTGCCGGCAGGAGCGGCAGG - Exonic
1163479825 19:17548476-17548498 GAGGTGCGGGTGGGAGCTGGAGG + Intronic
1163701468 19:18788782-18788804 GAGGTGGGGCGAGCGGCGGGCGG - Intronic
1163842260 19:19618617-19618639 GCGGGGCGGCCATGAGCGGCAGG + Exonic
1163851124 19:19664079-19664101 GAGGCGGGGCCCGGTGCGGGGGG + Intergenic
1164560249 19:29286905-29286927 GAATTGGGGCCGGGAGCGGGTGG + Intergenic
1165236788 19:34428365-34428387 GAGCCGCGGCCGGAAGCGGGTGG - Exonic
1165342958 19:35225385-35225407 GGGGTGGGGCCAGTAACGGGTGG - Intronic
1165467856 19:35985760-35985782 GAAGAGGGGCCAGCAGCGGGGGG - Intergenic
1167557061 19:50203346-50203368 GGGGGGCGGCCGGGGGCGGGAGG - Intronic
1167714100 19:51129939-51129961 GAGGAGCGGGCAGAAGCTGGGGG - Intronic
1167870958 19:52369881-52369903 GAGGCGAGGCCAGGCCCGGGTGG - Intergenic
1168404331 19:56102998-56103020 GAGGGGAGGCCAGGGTCGGGTGG + Intronic
1168721900 19:58558787-58558809 GGGGTGCGGCTAGGGGTGGGAGG + Exonic
925368061 2:3324574-3324596 AAGGTGCCGCCTTGAGCGGGTGG - Intronic
926166893 2:10526612-10526634 GAGGTGCCGCCCGCAGCAGGCGG - Intergenic
926392916 2:12412436-12412458 GACCTGAGGCCAGGTGCGGGTGG - Intergenic
927053691 2:19351798-19351820 GGGGTGGGGGCAGGGGCGGGAGG + Exonic
927513319 2:23658088-23658110 GAGGAGTGGGCAGGAGAGGGAGG - Intronic
928772479 2:34719358-34719380 GTGGTGCGGCCGGCAGGGGGCGG + Intergenic
932301792 2:70672623-70672645 GAGTTGGGGCAAGGAGCCGGGGG + Intronic
932418749 2:71589052-71589074 GAGGTGGGGACAGGAGTGGGTGG - Intronic
934025806 2:88000652-88000674 GACTTGAGGCCAGGAGCTGGAGG + Intergenic
936468629 2:112777003-112777025 GAGCTGCCGACAGGAGGGGGCGG - Intronic
936561236 2:113541597-113541619 AGGCTGCGGCCAGGCGCGGGTGG + Intergenic
937875930 2:126825314-126825336 GAGGTGGGGCCTGGTGGGGGTGG + Intergenic
937911521 2:127077936-127077958 AAGGTGGGCCCAGGAGCGGTGGG + Intronic
937934253 2:127230071-127230093 GTGGTGCAGCCTGGAGCGTGTGG - Intergenic
939990880 2:148875925-148875947 GAGAGGCGGCCGGGAGCGGCGGG + Intronic
946339982 2:219060602-219060624 GTGGTGCGGCCAGGGCCGGCGGG + Intergenic
946431029 2:219627560-219627582 GAGGTGCGGAGCGGAGCGCGAGG + Exonic
947793520 2:232880683-232880705 CAGGGGTGGCCAGGAGCTGGGGG + Intronic
948581095 2:238987717-238987739 CAGGCGCTGCCCGGAGCGGGAGG - Intergenic
948917347 2:241041180-241041202 GAGGGTGGGGCAGGAGCGGGAGG + Intronic
949047343 2:241877955-241877977 GGGGGGCGGCCAGGAGAGGGAGG - Intergenic
949047385 2:241878045-241878067 GGGGGGCGGCCAGGAGAGGGAGG - Intergenic
1169326587 20:4681716-4681738 GAGGAGTGGGCAGGAGCTGGAGG - Intergenic
1169524448 20:6408226-6408248 GAGGTGGGGCCTGGGGTGGGAGG + Intergenic
1169550579 20:6697613-6697635 GAGCTGCGGCCACGGGAGGGAGG - Intergenic
1170852456 20:20017471-20017493 GAGGCCCGGCCAAGAGCGGCTGG - Intronic
1172390464 20:34561730-34561752 GAGGTGGAGCCGGGAGAGGGCGG - Intronic
1172914795 20:38435390-38435412 GAGCTGCGGCCTAGAGCGGTAGG + Intergenic
1173785805 20:45792055-45792077 GAGGGGCGGCTTGGAGCTGGGGG + Exonic
1175380170 20:58557383-58557405 GTGGAGCAGCCAGGAGCTGGAGG + Intergenic
1175547539 20:59788393-59788415 GAGGGGCTGCCAGGCGTGGGGGG - Intronic
1175831072 20:61965792-61965814 GAGGAGGAGCCAGGGGCGGGGGG - Intronic
1175888833 20:62307209-62307231 GAGGAGCGGCGTGGGGCGGGTGG - Intronic
1176256957 20:64157985-64158007 AAGGTGGGGACAGGAGCAGGTGG - Intronic
1176298023 21:5084758-5084780 GAGCTGAGGCCGGGAGCAGGAGG - Intergenic
1179859006 21:44177191-44177213 GAGCTGAGGCCGGGAGCAGGAGG + Intergenic
1180763096 22:18223659-18223681 GAGATGCGGCGTGGAGGGGGCGG + Intergenic
1180772549 22:18400888-18400910 GAGATGCGGCGTGGAGGGGGCGG - Intergenic
1180803929 22:18650504-18650526 GAGATGCGGCGTGGAGGGGGCGG - Intergenic
1180806834 22:18718945-18718967 GAGATGCGGCGTGGAGGGGGCGG + Intergenic
1181041788 22:20195731-20195753 GATGTGGGGGCAGGTGCGGGTGG + Intergenic
1181217789 22:21344755-21344777 GAGATGCGGCGTGGAGGGGGCGG + Intergenic
1182715178 22:32352577-32352599 GAGGTGCAGCCAGGGGAAGGAGG - Intergenic
1183194547 22:36344448-36344470 GAGGTGCTGCCTGGATGGGGAGG - Intronic
1183359060 22:37374003-37374025 GAGGTGCGCACAGGCGCCGGCGG - Exonic
1183404465 22:37623675-37623697 GAGGTGGGGGCAGGAGGTGGAGG - Intronic
1183733490 22:39630985-39631007 GAGGTGGGGCCAGACTCGGGAGG + Intronic
1184333473 22:43840226-43840248 GGGGTAAGGCCAGGAGCAGGGGG + Intronic
1184778741 22:46635746-46635768 CAGGAGTGGCCAGGGGCGGGGGG - Intronic
1185164923 22:49255551-49255573 GAGGCTCAGGCAGGAGCGGGTGG - Intergenic
1203234387 22_KI270731v1_random:141876-141898 GAGATGCGGCGTGGAGGGGGCGG - Intergenic
952126949 3:30311969-30311991 GAAGTGGCGCCAGGAGCTGGCGG + Intergenic
952860796 3:37810804-37810826 TAGGTGGGGCCAGGGGCTGGTGG - Intronic
953055449 3:39383967-39383989 GAGGAGAGGCCAGGAGCTGCAGG + Intronic
953289760 3:41649514-41649536 GAGGAGGTGCCAGGAGCAGGGGG - Intronic
957145992 3:76424484-76424506 GGGTTGCTGCCAGGAGCTGGGGG + Intronic
960096741 3:113696652-113696674 GAGGGGCGGGGAGGGGCGGGGGG - Intergenic
960872158 3:122260903-122260925 GGGGTGCGGGGAGGAGAGGGAGG + Intronic
960941307 3:122936810-122936832 GAGGTGCAGCTAGGAGCAGATGG - Intronic
961331756 3:126146815-126146837 GAGGTAAGGCCAGGAGTGGAGGG - Exonic
962235294 3:133701711-133701733 GAGCTGAGGTCAGGAGCAGGGGG + Intergenic
963903460 3:150754469-150754491 GAGGTGGGGCCTGGGGCAGGTGG - Intronic
964475735 3:157096162-157096184 GTGGTGGGGCCAGGCACGGGTGG - Intergenic
965540828 3:169869937-169869959 GTGGTGCGGCAGGGAGTGGGGGG - Intergenic
967915596 3:194576067-194576089 GAGGAGAGGCCAGGAGGAGGCGG - Intergenic
968233334 3:197016909-197016931 GAGGGCTGGCCAGGAGAGGGGGG - Intronic
968445205 4:648970-648992 GAGAGGCGGCCAGGAGGGGCGGG + Intronic
968452915 4:683542-683564 GTGGTGAGGCCCGGAGAGGGCGG - Intronic
968606621 4:1538426-1538448 GAGGTGAGGGGAGGAGTGGGAGG + Intergenic
968633931 4:1667991-1668013 GAGGCGCGGCTAGGAGGGGAGGG + Intronic
975166737 4:71186652-71186674 GAGCAGCGGCCCGGAGCGGTGGG + Intergenic
977231026 4:94451832-94451854 GAGGCGTGGCCGGGAGCGGAGGG + Intergenic
978618124 4:110615464-110615486 GAGGTGCGGAAAGGGGCAGGCGG + Intergenic
981033972 4:140152086-140152108 GGGGAGCGGCCTGGAGGGGGCGG - Intronic
981683743 4:147429843-147429865 CAGGTGAGGCAAGGAGAGGGAGG + Intergenic
982712162 4:158768832-158768854 GAGGTGCGGCCAGGAGCGGGCGG - Intergenic
982745599 4:159102640-159102662 GGCGTGGCGCCAGGAGCGGGCGG + Intergenic
983923408 4:173371125-173371147 GCGGAGCGGCCAGGAGAGAGGGG + Exonic
984908291 4:184649498-184649520 GAGGGGCCGACAGGGGCGGGCGG - Intronic
986116517 5:4780580-4780602 GAGGGGAGGTCAGGAGCGAGAGG + Intergenic
986918995 5:12661910-12661932 GAGGTGCGGGCGGGAACCGGGGG + Intergenic
987816096 5:22902169-22902191 CAGCTGCGCCCAGGAGCAGGGGG + Intergenic
989145249 5:38243032-38243054 GAGGTGCTACCAGGAGTGGTCGG - Intergenic
992527927 5:77630025-77630047 GAGGGGCGGCCGGGAGACGGGGG + Exonic
994223801 5:97228636-97228658 GAGGAGAGGACAGGAGAGGGTGG + Intergenic
997352178 5:133238981-133239003 GAGGTGTGGAGAGGCGCGGGCGG + Intronic
998006720 5:138661992-138662014 GAGCTGCTTCAAGGAGCGGGTGG - Intronic
999225689 5:150021985-150022007 CAGGAGCGGGCAGGAGCGGGCGG + Intronic
999242134 5:150133833-150133855 GAGGAGGGGCCAGGAACGGGTGG - Intronic
999286789 5:150398953-150398975 GAGGTGGGGGCAGCAGTGGGTGG + Intronic
1001503776 5:172260056-172260078 GGGGTGCGGCGGGGAGGGGGTGG - Intronic
1001566148 5:172700742-172700764 GTGGTGGGGCGGGGAGCGGGGGG - Intergenic
1001695558 5:173667374-173667396 GAGATGGGGCCTGGAGCAGGTGG - Intergenic
1002058224 5:176610578-176610600 GAAGTGCGGCCGGGGGTGGGGGG - Intergenic
1002092281 5:176812582-176812604 GTGCTGCGGCCTGGAGCGGGGGG + Intronic
1002106368 5:176881251-176881273 GAGGTGTGGCCAGGTGGGGCTGG - Intronic
1002204701 5:177554408-177554430 GCGGTGCGGGCAGGCGCGAGCGG - Exonic
1002888075 6:1312987-1313009 GCGGCGGGGCCAGGCGCGGGCGG + Exonic
1004720622 6:18264779-18264801 GCGGGGCGGGCGGGAGCGGGAGG + Exonic
1005401297 6:25436964-25436986 GAGGTGTGGGCAGCAGTGGGTGG + Intronic
1006052039 6:31352716-31352738 GAGGTGCGGCCAGAACAGGTGGG - Intronic
1006579172 6:35066741-35066763 GAGGTGAGGCCAGGGGTGGCTGG + Intronic
1006615890 6:35326606-35326628 AAGGGGCGGCCAGGCGCGGTTGG + Intergenic
1007535679 6:42586274-42586296 GAGTTGAGCCCAGGAGTGGGAGG + Intronic
1009553117 6:65125753-65125775 GAGGTGGGGCCAGGAGGGGAAGG - Intronic
1010032829 6:71288616-71288638 GAGGCGCGGCCTGGGGCCGGTGG + Intergenic
1013035284 6:106376491-106376513 GAGGAGAGGGCAGGAGTGGGAGG + Intergenic
1016756488 6:147693289-147693311 GAGGTGCGGTGAGGAATGGGAGG + Intronic
1017687762 6:156930170-156930192 GAGGTGGGGCCAGGTGGGAGAGG + Intronic
1017881332 6:158564647-158564669 GAGTTGCTGGCAGGTGCGGGTGG - Intronic
1018923803 6:168193340-168193362 GATGGGCTGGCAGGAGCGGGAGG + Intergenic
1018964793 6:168475903-168475925 GAGGGGCAGGCAGGAGCAGGTGG + Intronic
1019092858 6:169554158-169554180 GAGCTGAGGCTAGAAGCGGGTGG + Intronic
1019196578 6:170286758-170286780 GAGGTGGGGCCGGGGGCGCGGGG - Intronic
1019321723 7:419065-419087 GAGGGGCAGCCAGGAGTGAGCGG + Intergenic
1019387300 7:764570-764592 GAGCTGCAGGCGGGAGCGGGAGG - Intronic
1019564845 7:1674166-1674188 GAGGGGTGCCCAGGAGCCGGTGG + Intergenic
1021256039 7:18393535-18393557 GAGGTGAGGCAGGGAGGGGGAGG + Intronic
1021633113 7:22665578-22665600 GAAGGGCGGCGAGGAGCGTGGGG - Intergenic
1022018502 7:26376439-26376461 CAGGTGCGGCCGGGAGCCGCAGG - Intergenic
1022124469 7:27342129-27342151 GAAGTGAGGCCAGGAGGGGAAGG - Intergenic
1022541475 7:31139782-31139804 GAGGGGTGGGCAGGAGGGGGAGG - Intergenic
1022675440 7:32495343-32495365 GTGGGGCGGGGAGGAGCGGGGGG - Intergenic
1023866223 7:44239543-44239565 GAGGGACGGGCGGGAGCGGGCGG + Intronic
1024217199 7:47257385-47257407 GAGGTGCTGGCAGGAAGGGGAGG + Intergenic
1025615555 7:63113820-63113842 GACGTGCGGGCAGGACCGGGTGG + Intergenic
1026540766 7:71278058-71278080 GATGTGTGCCCAGGAGAGGGTGG + Intronic
1026824752 7:73574388-73574410 GAGCTGCAGCCAGGAGGCGGTGG + Exonic
1026837371 7:73647803-73647825 GCGGCGCGGCCAGGGGCGGGCGG + Intergenic
1026964235 7:74429225-74429247 GAGGTGTGGGCAGGGGCGGGGGG - Intergenic
1027201406 7:76066097-76066119 GAGCTGCGGTCAGGAGTGCGAGG - Intronic
1027265723 7:76494245-76494267 GAGGTGGGGGCAGGAGGGAGAGG + Intronic
1027317094 7:76992362-76992384 GAGGTGGGGGCAGGAGGGAGAGG + Intergenic
1029659019 7:101946643-101946665 GGAGTGAGGCCAGGAGCTGGTGG + Intronic
1032090798 7:128910581-128910603 AAGGTGAGTCCAGGTGCGGGAGG - Exonic
1032504614 7:132425815-132425837 GAGGTGGGGGCGGGAGCTGGGGG + Intronic
1033026677 7:137781228-137781250 GAGGTGTGGCCAGGAGCCTAAGG + Intronic
1033290579 7:140079426-140079448 GAAGCGAGGCCAGGAGCAGGTGG + Intergenic
1033707731 7:143905190-143905212 GAGGGGTGGCCAGTAGCGGGAGG - Intergenic
1033742230 7:144284277-144284299 GAGGTGCGTCCAGCAGAGGCAGG + Intergenic
1033751672 7:144365337-144365359 GAGGTGCGTCCAGCAGAGGCAGG - Exonic
1034493882 7:151409189-151409211 AGGGTGCGGCCGGGATCGGGTGG - Intronic
1034837325 7:154364529-154364551 GAGGTGAGGGCAGGGGCGGTGGG + Intronic
1035075852 7:156176823-156176845 GAGCTGTGGCCAGGAGGAGGGGG + Intergenic
1035203242 7:157279694-157279716 GGGCTGCGGGCTGGAGCGGGCGG - Intergenic
1035769596 8:2136356-2136378 GAGGTGGGGCCAGAAGCATGTGG + Intronic
1035892172 8:3357039-3357061 GAGGTGGGGCTAGGAGGGTGGGG + Intronic
1037673727 8:21037040-21037062 GAGGGGCGTCCCGGAGCGGCAGG + Intergenic
1038241695 8:25815439-25815461 GAGCTAAGGCCAGGCGCGGGTGG + Intergenic
1038644473 8:29350840-29350862 GAGGAGGGGCCCGGAGGGGGCGG - Intergenic
1041489070 8:58411467-58411489 CAGGTGAGGCGAGGAGCCGGGGG + Exonic
1041739056 8:61139510-61139532 GTGGCGCTGCCAGCAGCGGGAGG + Intronic
1043053544 8:75409150-75409172 AAGGTGTGGCAAGGAGAGGGAGG + Intronic
1044870437 8:96614638-96614660 GAGGTGCTACCAGGAGAGTGGGG + Intergenic
1045231399 8:100310151-100310173 GCGGGGCGGCCGGGGGCGGGAGG - Intronic
1045675015 8:104597905-104597927 GAGGAGTGCCCAGGAGCGGTAGG + Intronic
1047526606 8:125639073-125639095 GAAGAGCGGGCAGGAGCAGGTGG + Intergenic
1047747267 8:127854304-127854326 GAGCTGCCTCCAGGAGCAGGGGG - Intergenic
1047966757 8:130050779-130050801 AAGGTGAGGCCAGGAGCTGGAGG - Intergenic
1049006205 8:139857209-139857231 GAGGTGAGGCCAGAGGCTGGCGG + Intronic
1049466589 8:142753765-142753787 GGGGTGCGGGCAGGAGAGTGCGG - Intergenic
1049532363 8:143160735-143160757 GAGGGGCGGGGAGGAGGGGGAGG - Intergenic
1049603243 8:143517788-143517810 GCGGGGCAGGCAGGAGCGGGGGG - Intronic
1049688642 8:143949298-143949320 GAGGTGGGGCCAGGTGCTGGGGG + Intronic
1049763082 8:144339550-144339572 GAGGTGCGGCCAGCAGCAGAGGG - Intergenic
1049799159 8:144509809-144509831 GAGTTGCGGCCACGAGAAGGTGG - Exonic
1051193024 9:14534532-14534554 AAGGAGCGGCCAGGAGAGAGAGG + Intergenic
1051590957 9:18776697-18776719 GAGATGCAGCCAGGAGAGAGGGG - Intronic
1053070228 9:35096680-35096702 GAAGTTTGGCCAGGAGCGTGGGG + Intergenic
1053471958 9:38352947-38352969 CAGCTGCCGCCTGGAGCGGGAGG - Intergenic
1053576057 9:39358031-39358053 GAGCTGCAGCCAGGAGCCGGTGG - Intronic
1053840572 9:42185968-42185990 GAGCTGCAGCCAGGAGCCGGTGG - Intronic
1054097628 9:60916722-60916744 GAGCTGCAGCCAGGAGCCGGTGG - Intergenic
1054119030 9:61192352-61192374 GAGCTGCAGCCAGGAGCCGGTGG - Intronic
1054588722 9:66990210-66990232 GAGCTGCAGCCAGGAGCCGGTGG + Intergenic
1054826937 9:69582700-69582722 GAGGAGCCACCAGGAGTGGGTGG - Intronic
1057160434 9:92884839-92884861 AAGCTGCAGCCAGGAGCAGGTGG - Intergenic
1057638592 9:96795622-96795644 GAAGTGGGGCCTGGAGGGGGAGG - Intergenic
1059506731 9:114806016-114806038 GAGGTGCCTCCAGGAGCAGCAGG - Exonic
1060186514 9:121567156-121567178 CAGGTGGGGCCAGGGGCTGGGGG + Exonic
1060727366 9:126015538-126015560 GAGGTGCGTGCAGGAGTGGGCGG + Intergenic
1061250991 9:129426280-129426302 GAGGTGGGAACAGGAGCTGGTGG + Intergenic
1061497202 9:130981814-130981836 AAGGTGCGGTGAGGAGAGGGCGG - Intergenic
1062006096 9:134239325-134239347 CAGGTGCGGCAAGGAGAGGCAGG - Intergenic
1062372172 9:136245652-136245674 GCGGTGGGGCCGGGCGCGGGCGG - Exonic
1062390594 9:136332168-136332190 GAGGTGCGGCGGGCAGCGAGTGG + Intronic
1062393718 9:136344149-136344171 GAGGTGCGGACAGGATCGGGGGG + Intronic
1062393726 9:136344171-136344193 GAGGCGCGGACAGGAGCGGGGGG + Intronic
1062428857 9:136518098-136518120 GGGGTGCGGCCAGGTGGGGGTGG - Intronic
1062449890 9:136610946-136610968 CAGGTGCGGCCAGGCAGGGGGGG + Intergenic
1062449907 9:136610982-136611004 CAGGTGCGGCCAGGCAGGGGGGG + Intergenic
1062449924 9:136611018-136611040 CAGGTGCGGCCAGGCAGGGGGGG + Intergenic
1062449976 9:136611126-136611148 CAGGTGCGGCCAGGCAGGGGGGG + Intergenic
1062449993 9:136611162-136611184 CAGGTGCGGCCAGGCAGGGGGGG + Intergenic
1185736552 X:2500659-2500681 GAGGTGTGGCCGGGGGTGGGGGG - Intronic
1187447682 X:19373173-19373195 GAGGAGGGGCCAGGAGGAGGAGG + Intronic
1187950389 X:24465191-24465213 GAGGGGAGGCGAGGAGCGCGAGG - Intergenic
1189069284 X:37847259-37847281 GAGGGGTGGCCAGGAGCGCGCGG - Intronic
1189368812 X:40411685-40411707 GAGATGCGGCCAGTAGAGTGAGG + Intergenic
1189909346 X:45794411-45794433 GAGGTGGGGCCAGGGGTGGTAGG + Intergenic
1199457288 X:148043604-148043626 GATGAGCTGCCAGGAGCTGGAGG + Intergenic
1200003317 X:153072824-153072846 GAGGCGCGGCCAGGGGAGGAGGG + Intronic
1200004406 X:153077185-153077207 GAGGCGCGGCCAGGGGAGGAGGG - Intergenic